The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :
Solution
Error arise due to unpredictable fluctuation in temperature and voltage supply are random errors.
The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :
Error arise due to unpredictable fluctuation in temperature and voltage supply are random errors.
A metal wire has mass , radius and length . The maximum possible percentage error in the measurement of density will nearly be :
A vehicle travels half the distance with speed and the remaining distance with speed . Its average speed is :

A bullet is fired from a gun at the speed of in the direction above the horizontal. The maximum height attained by the bullet is
:-
A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity . The ball strikes the water surface after . The height of bridge above water surface is (Take )

A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :
Southward
Eastward
= Along North - East

Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15
.
To find the maximum acceleration () of the car that allows a body to stay stationary relative to the car, we use the concept of static friction. Static friction () is what keeps the body from sliding on the car's floor. It acts in the opposite direction of the potential movement of the body.
The maximum static friction force is given by where is the coefficient of static friction and is the normal force. In this scenario, the normal force is equal to the gravitational force on the body (), where is the mass of the body and is the acceleration due to gravity.
Since the maximum force of static friction equals the product of the mass and the maximum acceleration (), we have:
By canceling out the mass on both sides, we get:
Substituting the given values ( and ):
Therefore, the maximum acceleration of the car to ensure the body remains stationary with respect to the car's floor is .
A bullet from a gun is fired on a rectangular wooden block with velocity . When bullet travels through the block along its length horizontally, velocity of bullet becomes . Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is :
..... (1)
Similarly from starting
..... (2)
The potential energy of a long spring when stretched by is U. If the spring is stretched by , potential energy stored in it will be :
The potential energy (U) stored in a spring when it is stretched or compressed is given by the formula:
where:
If the spring is initially stretched by cm (or meters, since we generally use SI units for these calculations), the potential energy stored can be represented as:
When the spring is stretched by cm (or meters), the new potential energy becomes:
To find the relation between and , we can divide the expression for by that of :
Simplifying this quotient gives:
Thus, if the spring's displacement is increased from cm to cm, the potential energy stored in the spring increases by a factor of , meaning:
The ratio of radius of gyration of a solid sphere of mass and radius about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :-
To solve this problem, we need to find the ratio of the radius of gyration for a solid sphere (K₁) to the radius of gyration for a thin hollow sphere (K₂) of the same mass M and radius R.
The moment of inertia (I) of a solid sphere about its own axis is given by :
The radius of gyration (K) is related to the moment of inertia (I) and mass (M) by the formula :
So for the solid sphere, we can find K₁ using :
Now, for a thin hollow sphere, the moment of inertia about its axis is given by :
We can find K₂ using :
Now, we need to find the ratio K₁ : K₂ :
The R terms cancel out, and we are left with :
Simplify by taking the square root of the fraction :
Now, the square root of 2 terms cancel out, giving us :
The angular acceleration of a body, moving along the circumference of a circle, is :

Along the axis of rotation.
Two bodies of mass and are placed at a distance . The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be ( gravitational constant) :

Position of Neutral point (Zero Gravitational Field)
Now Gravitational potential at point
A satellite is orbiting just above the surface of the earth with period . If is the density of the earth and is the universal constant of gravitation, the quantity represents :
For a satellite orbiting just above the surface of the Earth, we can use the formula for the period T of the satellite in terms of the Earth's density d and the gravitational constant G:
where a is the semi-major axis of the orbit (which is approximately equal to the Earth's radius R for a satellite orbiting just above the surface) and M is the mass of the Earth.
We can express the mass of the Earth M in terms of its density d and volume:
Now, substitute this expression for M into the equation for T:
Since the satellite is orbiting just above the Earth's surface, we can approximate a ≈ R:
Simplify the equation:
Now, square both sides of the equation:
Simplify further:
Thus, the quantity represents .
The amount of energy required to form a soap bubble of radius from a soap solution is nearly: (surface tension of soap solution )
The venturi-meter works on :
Let a wire be suspended from the ceiling (rigid support) and stretched by a weight attached at its free end. The longitudinal stress at any point of cross-sectional area of the wire is :
When a wire is suspended from the ceiling and stretched by a weight W attached at its free end, the force acting on the wire is equal to the weight W. This force causes longitudinal stress in the wire.
Longitudinal stress is defined as the force acting on an object divided by its cross-sectional area. In this case, the force acting on the wire is W, and the cross-sectional area of the wire is A.
Thus, the longitudinal stress at any point of the wire with cross-sectional area A is given by :
The temperature of a gas is . To what temperature the gas should be heated so that the rms speed is increased by times?
let initial speed is
As speed is increased by times so final speed become
So temp. in
A Carnot engine has an efficiency of when its source is at a temperature . The temperature of the sink is :-
Efficiency of carnot engine
So temp. of sink is
The - graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at is :

The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is
The fundamental frequency of an open pipe, noop, is given by V / (2L), where V is the speed of sound and L is the length of the pipe.
For a closed pipe of the same length, the fundamental frequency, ncop, is V / (4L) since only half as many wavelengths fit into the same length due to the closed end.
Therefore, the ratio of frequencies of an open pipe to a closed pipe is:
This shows that the fundamental frequency of an open pipe is twice that of a closed pipe of the same length.
An electric dipole is placed at an angle of with an electric field of intensity . It experiences a torque equal to . Calculate the magnitude of charge on the dipole, if the dipole length is .
The torque τ experienced by an electric dipole in an electric field is given by the formula:
where p is the electric dipole moment, E is the electric field intensity, and θ is the angle between the dipole and the electric field. The electric dipole moment p can be expressed as:
where q is the charge on the dipole, and d is the dipole length.
We are given the following values:
We need to find the charge q on the dipole. Let's first solve for the electric dipole moment p:
Substituting the given values:
Now, let's solve for the charge q using the formula:
Substituting the values for p and d:
So, the magnitude of the charge on the dipole is 2 mC.
If \oint_\limits{s} \vec{E} \cdot \overrightarrow{d S}=0 over a surface, then:
So,

Number of field lines entering is equal number of field lines leaving.
An electric dipole is placed as shown in the figure.

The electric potential (in 102 V) at point P due to the dipole is ( = permittivity of free space and = K) :

The magnitude and direction of the current in the following circuit is :-


from to through .
If the galvanometer does not show any deflection in the circuit shown, the value of is given by:

For no reading galvanometer. Potential across it is same.

Resistance of a carbon resistor determined from colour codes is . The colour of third band must be :
Acc. to color code
Third Band Orange
(color code for digit 3 is orange)
The resistance of platinum wire at is and at . The temperature coefficient of resistance of the wire is :
10 resistors, each of resistance are connected in series to a battery of emf and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased times. The value of is :
..... (1)
.... (2)
The equivalent capacitance of the system shown in the following circuit is:


A wire carrying a current along the positive -axis has length . It is kept in a magnetic field . The magnitude of the magnetic force acting on the wire is :
A very long conducting wire is bent in a semi-circular shape from to as shown in figure. The magnetic field at point for steady current configuration is given by :

outward i.e. away from page.
The net magnetic flux through any closed surface is :
Magnetic field exist in
Closed Loops (Monopoles do not exist)
(Gauss law for magnetism)
In a series LCR circuit, the inductance is , capacitance is and resistance is . The frequency at which resonance occurs is :-
The goal is to find the frequency at which resonance occurs in a series LCR circuit. To achieve resonance, the inductive reactance () should equal the capacitive reactance ().
Given are:
Resonance occurs when the angular frequency () meets the condition , leading to the formula for calculating the resonance frequency () as .
Substituting the given values:
Thus, the frequency at which resonance occurs in this LCR circuit is 1.59 kHz.
A lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of . Assuming the transformer to be ideal, what is the current in the primary winding ?
To find the current in the primary winding of an ideal step-down transformer, we first understand that an ideal transformer's power input (primary side) equals its power output (secondary side). This is because an ideal transformer is assumed to have 100% efficiency, meaning there are no losses in the transformation process.
The power of the lamp (which is connected to the secondary side of the transformer) is given as , and it operates at . The voltage on the primary side of the transformer is .
Using the power formula , where is the power in watts, is the current in amperes, and is the voltage in volts, we equate the power on both sides of the transformer because of its ideal nature, i.e., .
Hence, .
Solving for gives:
.
Therefore, the current in the primary winding of the transformer is approximately .
An ac source is connected to a capacitor C. Due to decrease in its operating frequency
When an AC source is connected to a capacitor, the current (I) depends on the capacitive reactance (XC), where , with representing the angular frequency , and C denoting the capacitance.
The formula for capacitive reactance shows that it is inversely proportional to the frequency (f) of the operation.
Thus, if the frequency decreases, the capacitive reactance increases because and is proportional to frequency.
As capacitive reactance increases, the displacement current (I), which flows through the capacitor, decreases according to the relationship , with V being the voltage across the capacitor.
So, among the given choices, the correct interpretation is that the displacement current decreases with a decrease in operating frequency.
The magnetic energy stored in an inductor of inductance carrying a current of is :
The formula for calculating the magnetic energy stored in an inductor is given by:
where:
Plugging the given values into the formula:
Hence, the energy stored in the inductor is .
The net impedance of circuit (as shown in figure) will be :

To find the net impedance, Z, of the circuit, we need to calculate the inductive reactance (XL), the capacitive reactance (XC), and use the resistance (R) in the circuit. Since R is given as 10 , we calculate the reactances as follows:
Inductive reactance, , where is the frequency and is the inductance. With Hz and given as mH, or H, we find .
Capacitive reactance, , where is the capacitance. Given μF, or F, results in .
With these values, the net impedance of the circuit can be calculated using the formula:
Substituting , , and , we find:
Therefore, the correct option is .
In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of and amplitude . Then the amplitude of oscillating magnetic field is : (Speed of light in free space )
Light travels a distance in time in air and in time in another denser medium. What is the critical angle for this medium?
The critical angle, denoted as , is the angle of incidence beyond which light is totally internally reflected within a denser medium when it hits the boundary with a less dense medium. To find the critical angle for the medium in question, first, we need to understand the relationship between the speed of light in different media and their refractive indices.
Let's denote the speed of light in air as and in the denser medium as . From the given information:
(speed of light in air)
(speed of light in the denser medium)
The refractive index of a medium (n) is inversely proportional to the speed of light in that medium (, where c is the speed of light in vacuum). Thus, the refractive index of the denser medium () relative to air () can be obtained by taking the ratio of the speed of light in air to that in the denser medium:
Substituting the expressions for and :
For the critical angle , the light in the denser medium (index ) strikes the boundary with the less dense medium (index ) such that it refracts at 90 degrees (escapes along the boundary). Snell's Law at this boundary is:
Given that (approximating the refractive index of air), we simplify to:
Substituting from the earlier relation and simplifying:
Hence, the critical angle is given by:
In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin) ?


Use
Two thin lenses are of same focal lengths , but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :
For Young's double slit experiment, two statements are given below :
Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains constant.
Statement II : If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.
In the light of the above statements, choose the correct answer from the options given below :
In Young's double slit experiment, the angular separation of the fringes (θ) is given by :
where m is the fringe order, λ is the wavelength of the light, and d is the distance between the slits.
Now, let's analyze both statements:
Statement I: If the screen is moved away from the plane of the slits, the angular separation of the fringes remains constant.
This statement is true because the angular separation of the fringes (θ) does not depend on the distance between the screen and the slits. It only depends on the fringe order (m), the wavelength of the light (λ), and the distance between the slits (d).
Statement II: If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.
This statement is false because if the wavelength (λ) increases, the angular separation of the fringes (θ) also increases according to the formula :
So, the correct answer is :
Option B: Statement I is true but Statement II is false.
The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to of its initial value?
Half life
Left fraction of activity
In hydrogen spectrum, the shortest wavelength in the Balmer series is . The shortest wavelength in the Bracket series is :
Shortest wavelength in Balmer series when transition of from to
.... (1)
Shortest wavelength is Bracket series when transition of from to
..... (2)
Eq. (1) / Eq. (2)
The radius of inner most orbit of hydrogen atom is . What is the radius of third allowed orbit of hydrogen atom?
The formula to calculate the radius of the nth orbit in a hydrogen atom is given by the equation:
where,
is the radius of the nth orbit,
is the radius of the innermost orbit (known as the Bohr radius), and
is the orbit number.
Given that the radius of the innermost orbit () is or equivalently , and we're interested in finding the radius of the third orbit ().
So,
Therefore, the radius of the third allowed orbit of the hydrogen atom is 4.77 .
The work functions of Caesium , potassium and Sodium (Na) are and respectively. If incident electromagnetic radiation has an incident energy of , which of these photosensitive surfaces may emit photoelectrons?
Given energy of photon
Work function of
We know that emitts when
here it is clear that energy of photon is more than the work function of [Caesium] only so Ans. only (Cs).
The minimum wavelength of -rays produced by an electron accelerated through a potential difference of volts is proportional to :
The minimum wavelength, , of X-rays produced by an electron can be determined using the equation derived from the energy of a photon and the energy given to an electron by an accelerating voltage, .
The energy of a photon is given by , where is Planck's constant, is the speed of light, and is the wavelength of the photon.
When an electron is accelerated through a potential difference of volts, it gains kinetic energy equal to , where is the electron charge.
This energy is then converted into a photon's energy when the electron collides with a target in an X-ray tube, resulting in X-rays of wavelength . Setting the kinetic energy equal to the photon energy gives . Solving for gives .
Therefore, the minimum wavelength (corresponding to the maximum energy photon produced when all the kinetic energy is converted into photon energy) is inversely proportional to the voltage, .
Thus, .
Given below are two statements:
Statement I : Photovoltaic devices can convert optical radiation into electricity.
Statement II : Zener diode is designed to operate under reverse bias in breakdown region.
In the light of the above statements, choose the most appropriate answer from the options given below :
Statement I : Photocell/solar cell convert light energy into electric energy/current.
Statement II : We use zener diode in reverse biased condition, when reverse biased voltage more than break down voltage than it act as stablizer.
A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
Capacitor used to remove AC ripples from Rectifier output.
For the following logic circuit, the truth table is:

| A | B | Y |
|---|---|---|
| 0 | 0 | 0 |
| 0 | 1 | 1 |
| 1 | 0 | 1 |
| 1 | 1 | 1 |
| A | B | Y |
|---|---|---|
| 0 | 0 | 1 |
| 0 | 1 | 0 |
| 1 | 0 | 1 |
| 1 | 1 | 0 |
| A | B | Y |
|---|---|---|
| 0 | 0 | 0 |
| 0 | 1 | 0 |
| 1 | 0 | 0 |
| 1 | 1 | 1 |
| A | B | Y |
|---|---|---|
| 0 | 0 | 1 |
| 0 | 1 | 1 |
| 1 | 0 | 1 |
| 1 | 1 | 0 |
Gate
| A | B | Y |
|---|---|---|
| 0 | 0 | 0 |
| 0 | 1 | 1 |
| 1 | 0 | 1 |
| 1 | 1 | 1 |
The right option for the mass of produced by heating of pure limestone is
(Atomic mass of )
Weight of impure limestone
Weight of pure limestone of
Image
Select the correct Statements from the following :
A. Atoms of all elements are composed of two fundamental particles.
B. The mass of the electron is .
C. All the isotopes of a given elements show same chemical properties.
D. Protons and electrons are collectively known as nucleons.
E. Dalton's atomic theory, regarded the atom as an ultimate particle of matter.
Choose the correct answer from the options given below.
It is statement based question.
Statements B, C & E are correct.
(B) Mass of the electron is
(C) All the isotopes of given elements show same chemical properties.
(E) Dalton's atomic theory, regarded the atom as an ultimate particle of matter.
The relation between the number of permissible values of magnetic quantum number ) for a given value of azimuthal quantum number , is
Sol. Number of permissible values of magnetic quantum number for a given value of azimuthal quantum
On balancing the given redox reaction,
the coefficients and are found to be, respectively -
Reaction has to be balanced in acidic medium 'O' atoms are balanced by adding and then -atom is balanced by adding ions and charge is balanced by .
Oxidation:
Reduction:
Which amongst the following options is correct graphical representation of Boyle's law?




Boyle's law is defined at constant temperature for an ideal gas.
[straight line equation]
slope of P versus curve is
Slope
The equilibrium concentrations of the species in the reaction are and , respectively at for the reaction is
Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
The conductivity of centimolar solution of at is and the resistance of the cell containing the solution at is . The value of cell constant is -
Centimolar solution
Conductivity
Resistance
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : In equation , value of depends on n.
Reason R : is an intensive property and is an extensive property.
In the light of the above statements, choose the correct answer from the options given below:
is an intensive property and is an extensive property as it depends on number of transferred in cell reaction.
For a certain reaction, the rate , when the initial concentration of A is tripled keeping concentration of constant, the initial rate would
Rate
If is tripled and is kept constant.
Increased by a factor of nine
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : A reaction can have zero activation energy.
Reason R : The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer from the options given below:
A reaction cannot have zero activation energy.
is minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value.
A compound is formed by two elements A and B. The elements B forms cubic close packed structure and atoms of A occupy of tetrahedral voids. If the formula of the compound is , then the value of is in option

What fraction of one edge centred octahedral void lies in one unit cell of fcc?
Edge centred octahedral void is shared between four unit cells
Per unit cell contribution is 1/4
Which one is an example of heterogenous catalysis?
(1) (Homogeneous reaction)
(2) (Homogeneous reaction)
(3) (Reactants and catalyst are in different phase) It is heterogeneous reaction
(4)
Pumice stone is an example of -
Pumice stone is an example of solid state
Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is
:
Total number of species = 3

The correct order of energies of molecular orbitals of molecule, is
Molecular orbital (energy) diagram / sequence of N

Taking stability as the factor, which one of the following represents correct relationship?
T & I > T & 3I
due to inert pair effect T is more stable than T.
Intermolecular forces are forces of attraction and repulsion between interacting particles that will include:
A. dipole - dipole forces.
B. dipole - induced dipole forces
C. hydrogen bonding
D. covalent bonding
E. dispersion forces
Choose the most appropriate answer from the options given below :
Intermolecular forces means force of attraction between two or more molecules
dipole-dipole (attraction between two or more polar molecules).
Dipole induced dipole (attraction between polar and non polar molecules)
Hydrogen bonding (it is a special type of dipole-dipole and ion-dipole attraction)
Dispersion forces (mainly acts between non polar molecules).
Covalent bonding (acts between atom not between molecules )
The reaction that does NOT take place in blast furnace between 900 K to 1500 K temperature range during extraction of iron is :
Reaction
This reaction takes place at temperature (500 K - 800 K) not at (900 K to 1500 K)
Given below are two statements : one is labelled as Assertion and the other is labelled as Reason :
Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.
Reason R : The deep blue solution is due to the formation of amide.
In the light of the above statements, choose the correct answer from the options given below :
Assertion is correct because all Alkali metals gives deep blue solution by giving electrons.
Reason is incorrect because deep blue solution appears due to the presence of ammoniated electron or solvated electrons.
Which one of the following statements is correct?
The daily requirement in the human body has been estimated to be 200-300 mg (NCERT : s-block) Biological importance of magnesium and calcium.
Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is :

Weight g
Which of the following statements are NOT correct?
A. Hydrogen is used to reduce heavy metal oxides to metals.
B. Heavy water is used to study reaction mechanism.
C. Hydrogen is used to make saturated fats from oils
D. The bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element.
E. Hydrogen reduces oxides of metals that are more active than iron.
Choose the most appropriate answer from the options given below:
(D, E) explanation
(D) bond strength/ bond dissociation energy/bond energy of can not be lowest because bond formed between hydrogen atoms is due to overlapping of -.
(E) Hydrogen can not reduces oxides of highly reactive metal.
Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Helium is used to dilute oxygen in diving apparatus.
Reason R : Helium has high solubility in O.
In the light of the above statements, choose the correct answer from the options given below:
Assertion is true because He has low solubility in blood. (NCERT)
Match List I with List II:
| List I |
List II |
||
|---|---|---|---|
| (A) | Coke | (I) | Carbon atoms are sp hybridised |
| (B) | Diamond | (II) | Used as a dry lubricant |
| (C) | Fullerene | (III) | Used as a reducing agent |
| (D) | Graphite | (IV) | Cage like molecules |
Choose the correct answer from the options given below:
Coke : It is used as reducing agent in carbon reduction methods. (in metallurgical process)
Diamond : It is a allotrope of carbon in which each carbon is hybridised.

Fullerene : It contains pentagonal & hexagonal rings (cage like structure)
Graphite : It is soft solid because graphite layers are bonded with weak Vander Wall attractions.
The element expected to form largest ion to achieve the nearest noble gas configuration is
all ions are isoelectronic containing
order of radius
Nitrogen to achieve Noble gas configuration it gain , & form
Match List I with List II:
| List I (Oxoacids of Sulphur) |
List II (Bonds) |
||
|---|---|---|---|
| (A) | Peroxodisulphuric acid | (I) | Two S-OH, Four S=O, One S-O-S |
| (B) | Sulphuric acid | (II) | Two S-OH, One S=O |
| (C) | Pyrosulphuric acid | (III) | Two S-OH, Four S=O, One S-O-O-S |
| (D) | Sulphurous acid | (IV) | Two S-OH, Two S=O |
Choose the correct answer from the options given below:

The stability of is more than salts in aqueous solution due to -

is more stable than because released hydration energy is more in case of than .
Which of the following statements are INCORRECT?
A. All the transition metals except scandium form MO oxides which are ionic.
B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in to .
C. Basic character increases from to to .
D. dissolves in acids to give salts.
E. is basic but is amphoteric.
Choose the correct answer from the options given below:

dissolve in acid to give salts. This doesn't shown by
Homoleptic complex from the following complexes is :
(1)
(2)
(3)
(4)
Option 4 contain all ligands are of same type i.e. why complex will be homoleptic.
Which complex compound is most stable?
due to Chelation effect of (en).
Given below are two statements:
Statement I : The nutrient deficient water bodies lead to eutrophication.
Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies.
In the light of the above statements, choose the correct answer from the options given below:
The correct answer is Option C : Statement I is incorrect but Statement II is true.
Statement I is incorrect. Eutrophication is not caused by nutrient-deficient water bodies, but rather by nutrient-rich water bodies. This process typically occurs when a body of water becomes overly enriched with nutrients (like phosphates and nitrates), often due to runoff from the land, which causes a dense growth of plant life, particularly algae blooms.
Statement II is true. The excessive plant growth and algal blooms caused by eutrophication can deplete the oxygen levels in the water when these organisms die and decompose. This can lead to the death of animal life, particularly fish, in the affected water body, a condition known as hypoxia.
The number of bonds, bonds and lone pair of electrons in pyridine, respectively are:

In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with due to the formation of-
Sol. In case nitrogen and sulphur both are present in an organic compound, sodium thiocyanate is formed, it give blood red colour and no prussian blue since there are no free cyanide Ions
Blood red
Amongst the given options which of the following molecules/ion acts as a Lewis acid?

can not act as lewis acid because they does not contain vacant orbital
BF Contains vacant orbital on central atom (Boron).
Consider the following compounds/species:

The number of compounds/species which obey Huckel's rule is ___________.
Huckle's rule = (4n + 2) electrons
Comp (i), (ii), (v), (vii) obey Huckle's rule
Identify product is the following reaction :






The given compound

is an example of _________.

Consider the following reaction and identify the product (P).





Consider the following reaction

Identify products A and B :-





Which amongst the following will be most readily dehydrated under acidic conditions?




Due to presence of conjugation in product.

Complete the following reaction:

[C] is _______.





Identify the major product obtained in the following reaction:






Identify the final product [D] obtained in the following sequence of reactions.




Identify the product in the following reaction:






Which of the following reactions will NOT give primary amine as the product?


Which amongst the following molecules on polymerization produces neoprene?



Given below are two statements:
Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside
Statement II : When nucleoside is linked to phosphorous acid at 5' position of sugar moiety, we get nucleotide.
In the light of the above statements, choose the correct answer from the options given below:

Base link with 1' position of sugar in nucleoside so statement I is correct.

When nucleoside is linked to phosphoric acid at 5' position of sugar moiety we get a nucleotide
Statement II is incorrect because not link with phosphorous acid.
Some tranquilizers are listed below. Which one from the following belongs to barbiturates?
Veronal is an example of barbiturates.
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as dedifferentiation.
Dedifferentiation is a phenomenon by which the living differentiated plant cells, that by now have lost the capacity to divide can regain the capacity of division under certain conditions.
How many different proteins does the ribosome consist of?
The ribosome consists of structural RNAs and about 80 different proteins.
Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below:
Which of the following functions is carried out by cytoskeleton in a cell?
An elaborate network of filamentous proteinaceous structures consisting of microtubules, microfilaments and intermediate filaments present in cytoplasm is collectively referred to as the cytoskeleton. It is involved in many functions such as mechanical support, motility, maintenance of the shape of the cell.
Cellulose does not form blue colour with Iodine because
Option (B) is the correct answer because cellulose does not contain complex helices and hence cannot hold iodine molecules.
Option (A), (C) and (D) are not correct as cellulose is a polysaccharide.
Given below are two statements:
Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal).
Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of type and two subunits of type.)
In the light of the above statements, choose the correct answer from the options given below:
The correct answer is option (C) as a protein is imagined as a line, the left end represented by the first amino acid and the right end is represented by the last amino acid. The first amino acid is also called N-terminal amino acid. The last amino acid is called the C-terminal amino acid.
Given below are two statements :
Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below:
Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as a competitive inhibitor.
So, the correct answer is :
Option D : Both Statement I and Statement II are true.
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
Which of the following stages of meiosis involves division of centromere?
The correct answer is Option B : Anaphase II.
During meiosis, the division of the centromere occurs in Anaphase II. At this stage, the sister chromatids of each chromosome (which are attached at the centromere) are pulled apart and move toward opposite poles of the cell. This is similar to what happens in anaphase of mitosis. In contrast, during Anaphase I of meiosis, homologous chromosomes are separated but the centromeres do not divide, meaning the sister chromatids stay together.
Among eukaryotes, replication of DNA takes place in :
Match List I with List II:
| List I | List II | ||
|---|---|---|---|
| (A) | M Phase | (I) | Proteins are synthesized |
| (B) | G Phase | (II) | Inactive phase |
| (C) | Quiescent stage | (III) | Interval between mitosis and initiation of DNA replication |
| (D) | G Phase | (IV) | Equational division |
Choose the correct answer from the options given below :
M phase or mitosis is the phase where the actual cell division occurs. Mitosis is also called equational division.
During G2 phase DNA synthesis stops but cell synthesis RNA, proteins, etc. for next phase.
Quiescent stage is inactive phase in which non-dividing cells enters.
G1 phase is the interval between mitosis and initiation of DNA replication.
Therefore, option (B) is correct.
Select the correct statements.
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:
Given below are two statements:
Statement I : During G0 phase of cell cycle, the cell is metabolically inactive.
Statement II : The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below:
What is the function of tassels in the corn cob?
Tassels in the com cob represents stigma and style which wave in the wind to trap pollen grains.
Large, colourful, fragrant flowers with nectar are seen in
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
Synergids are the cells of gametophyte and hence these are haploid Zygote is formed by fusion of two gametes and thus it is diploid.
Primary endosperm nucleus is formed by the fusion of diploid secondary nucleus with a male gamete. Therefore, it is triploid.
Given below are two statements : One labelled as Assertion A and the other labelled as Reason R :
Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below :
The correct answer is Option B : A is true but R is false.
Assertion A is true. In gymnosperms, the pollen grains are indeed released from the microsporangium and are typically carried by air currents, a method of pollination known as anemophily.
Reason R is false. Although it's true that air currents carry the pollen grains, the pollen grains do not directly reach the mouth of the archegonia in gymnosperms. Instead, they land on the ovule, where they germinate and form a pollen tube that delivers the male gametes to the egg. Therefore, a pollen tube is formed in gymnosperms, contrary to what Reason R suggests.
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Late wood has fewer xylary elements with narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below :
Late wood, formed in the latter part of the growing season, indeed has fewer xylary elements with narrower vessels. This is because the cambium, the layer of cells in plants that gives rise to secondary xylem (wood), is less active in colder temperatures, which are typically associated with the later parts of the growing season, such as autumn and winter.
So, both Assertion A and Reason R are true. Moreover, Reason R correctly explains why Assertion A is the case: the decreased activity of the cambium in colder temperatures results in the formation of late wood with fewer, narrower vessels.
Therefore, the correct answer is :
Option D : Both A and R are true and R is the correct explanation of A.
Given below are two statements :
Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below:
Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
So, the correct answer is :
Option C : Statement I is incorrect but Statement II is true.
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
Movement and accumulation of ions across a membrane against their concentration gradient can be explained by active transport. It uses energy to transport molecules from lower concentration to a higher concentration.
Given below are two statements :
Statement I : The forces generated transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below :
Statement I is correct as measurements reveal that the forces generated by transpiration can create pressures sufficient to lift a xylem sized column of water up to 130 meters high.
Statement II is also correct. Transpiration has a cooling effect on plant tissues. As water evaporates from the surfaces of leaves, it removes heat, reducing the temperature. This process, known as evaporative cooling, can lower the temperature of the leaf surface by 10 to 15 degrees.
Identify the correct statements:
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark formed early in the season is called hard bark.
C. Bark is a technical term that refers to all tissues exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
E. Phellogen is single-layered in thickness.
Choose the correct answer from the options given below:
Lenticels are lens shaped opening permitting exchange of gases between the outer atmosphere and internal tissue of the stem.
Bark that is formed early in the season is called early or soft bark. Towards the end of the season late or hard bark is formed.
Bark is non-technical term that refer to all tissues exterior to vascular cambium.
Bark refers to a number of tissue types, viz periderm and secondary phloem.
Phellogen is couple of layers thick
Therefore, only statement A and D are correct.
Match List I with List II :
| List I | List II | ||
|---|---|---|---|
| (A) | Cohesion | (I) | More attraction in liquid phase |
| (B) | Adhesion | (II) | Mutual attraction among water molecules |
| (C) | Surface tension | (III) | Water loss in liquid phase |
| (D) | Guttation | (IV) | Attraction towards polar surfaces |
Choose the correct answer from the options given below :
The correct answer is :
Option D : A – II, B – IV, C – I, D – III
Explanation :
(A) Cohesion - (II) Mutual attraction among water molecules. Cohesion is the property that makes water molecules attracted to each other, causing them to stick together.
(B) Adhesion - (IV) Attraction towards polar surfaces. Adhesion is the property of different substances to bond with each other. In the context of water, it refers to water's ability to "stick" to polar surfaces.
(C) Surface tension - (I) More attraction in liquid phase. Surface tension is the property that allows the surface of a liquid to resist external force, due to the cohesive nature of its molecules. It's why small insects can walk on water without breaking the surface.
(D) Guttation - (III) Water loss in liquid phase. Guttation is the process in plants where water is lost from the edges of the leaves in the form of liquid droplets, typically when soil moisture levels are high.
Which micronutrient is required for splitting of water molecule during photosynthesis?
Manganese plays a major role in the splitting of water to liberate oxygen during photosynthesis.
Copper is essential for the overall metabolism in plants.
Molybdenum is included in nitrogen metabolism.
Magnesium activates several enzymes involved in photosynthesis and respiration.
Match List I with List II:
| List I | List II | ||
|---|---|---|---|
| (A) | Iron | (I) | Synthesis of auxin |
| (B) | Zinc | (II) | Component of nitrate reductase |
| (C) | Boron | (III) | Activator of catalase |
| (D) | Molybdenum | (IV) | Cell elongation and differentiation |
Choose the correct answer from the options given below:
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1, 6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below :
Which of the following combinations is required for chemiosmosis?
Chemiosmosis is a process by which ATP (adenosine triphosphate) is produced in the cell. It relies on a concentration gradient of protons (H+ ions) across a membrane. The proton gradient is created by a proton pump. As protons flow back across the membrane, down their concentration gradient, they pass through a protein complex called ATP synthase, which uses the energy of the proton flow to produce ATP.
So, the correct answer is :
Option D : Membrane, proton pump, proton gradient, ATP synthase
Match List I with List II:
| List I | List II | ||
|---|---|---|---|
| (A) | Oxidative decarboxylation | (I) | Citrate synthase |
| (B) | Glycolysis | (II) | Pyruvate dehydrogenase |
| (C) | Oxidative phosphorylation | (III) | Electron transport system |
| (D) | Tricarboxylic acid cycle | (IV) | EMP pathway |
Choose the correct answer from the options given below :
Pyruvate, which is formed by the glycolytic catabolism of carbohydrates in the cytosol, after it enters mitochondrial matrix undergoes oxidative decarboxylation by a complex set of reactions catalyzed by pyruvate dehydrogenase.
The scheme of glycolysis was given by Gustav Embden, Otto Meyrhof and J. Parnas, and is often referred to as the EMP pathway.
In electron transport system, the energy of oxidation-reduction is utilized for the production of proton gradient required for phosphorylation, thus, this process is also called oxidative phosphorylation.
The TCA (tricarboxylic acid cycle) starts with the condensation of acetyl group with oxaloacetic acid (OAA) and water to yield citric acid. The reaction is catalysed by the enzyme citrate synthase. Thus, option (C) is correct.
Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
Melonate is a known inhibitor of the enzyme succinic dehydrogenase, which is involved in the citric acid cycle (also known as the Krebs cycle or TCA cycle), an essential metabolic pathway in many organisms, including bacteria.
By inhibiting succinic dehydrogenase, melonate can disrupt the normal metabolism of pathogenic bacteria and inhibit their growth.
So, the correct answer is :
Option D : Succinic dehydrogenase
Which of the following is not a cloning vector?
Option (C) is correct answer because a single stranded DNA or RNA tagged with a radioactive molecule is called a probe and it helps in the detection of mutated gene.
Option (A), (B) and (D) are not correct because YAC, BAC, pBR322 are vectors.
Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?
Option D : Habitat loss and fragmentation is considered the most important cause driving extinction of species among 'The Evil Quartet'.
The 'Evil Quartet' refers to the four major causes of biodiversity loss: habitat destruction and fragmentation, over-exploitation, pollution, and invasive species. Of these, habitat loss and fragmentation is generally considered the most significant cause, as it directly affects the availability of the resources and space that organisms need to survive. It can be caused by a variety of human activities, including deforestation, urbanization, and agriculture. This loss of habitat leads to smaller, more isolated populations, which are more vulnerable to other threats and have a higher risk of extinction.
The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
Fabaceae Diadelphous and dithecous anther.
Solanaceae Polyandrous, epipetalous and dithecous anther.
Liliaceae Polyandrous, epiphyllous and dithecous anther.
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive node instead of leaves.
In the light of the above statements, choose the correct answer from the options given below :
The correct answer is :
Option D : Both A and R are true and R is the correct explanation of A
Explanation :
Statement A is true. A flower is indeed a modified shoot wherein the shoot apical meristem changes to a floral meristem.
Statement R is also true. In the process of flower formation, the internodes of the shoot get condensed, and instead of leaves, different floral appendages (such as sepals, petals, stamens, and carpels) are produced laterally at successive nodes.
Moreover, Statement R is indeed the correct explanation for Statement A. The transition from the shoot apical meristem to the floral meristem involves the condensation of internodes and the lateral production of floral appendages at nodes, which leads to the formation of a flower.
How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle?
For every CO2 molecule entering the Calvin cycle, 3 molecules of ATP and 2 of NADPH2 are required. To make one molecule of glucose, 6 turns of the cycle are required. Thus, ATP and NADPH2 molecules required for synthesis of one molecule of glucose during Calvin cycle will be

The reaction centre in PS II has an absorption maxima at
In PS-I, the reaction centre chlorophyll a has an absorption peak at 700 nm, while in PS-II, reaction centre has an absorption maxima at 680 nm.
Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
Alfred Sturtevant used the frequency of recombination between gene pairs on the same chromosome as a measure of the distance between genes and ‘mapped’ their position on the chromosome.
Sutton and Boveri proposed chromosomal theory of inheritance.
Henking discovered X-chromosome.
Thomas Hunt Morgan proved chromosomal theory of inheritance and proposed the concept of linkage.
The phenomenon of pleiotropism refers to
When a single gene affects multiple phenotypic expression, the gene is called pleiotropic gene and the phenomenon is called pleiotropism.
Which of the following statements are correct about Klinefelter’s Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below :
Option B :
B and E only
Explanation :
B. Such an individual has overall masculine development. However, the feminine development is also expressed. People with Klinefelter syndrome are male (XY), but they often have certain physical characteristics that may be typically associated with female development, such as wider hips, less body hair, and sometimes breast tissue development.
E. Such individuals are sterile. Often, individuals with Klinefelter syndrome produce little to no sperm and are therefore usually infertile. However, there are cases where fertility treatments can help some men with Klinefelter syndrome to father children.
For the other options :
A. This disorder was first described by Langdon Down (1866). This is incorrect. Klinefelter's syndrome was first described by Dr. Harry Klinefelter in the 1940s, not by Langdon Down.
C. The affected individual is short statured. This is incorrect. In fact, individuals with Klinefelter's syndrome are often taller than average.
D. Physical, psychomotor and mental development is retarded. This is also incorrect. While individuals with Klinefelter syndrome may have some learning difficulties or delays, particularly with language and speech, it is not accurate or appropriate to say that their physical, psychomotor, and mental development is "retarded". They may face some challenges, but with support they can lead healthy, productive lives.
Broad palm with single palm crease is visible in a person suffering from-
Which one of the following symbols represents mating between relatives in human pedigree analysis?




The symbol representing mating between relatives (consanguineous mating) in human pedigree analysis is

Unequivocal proof that DNA is the genetic material was first proposed by
The first unequivocal proof that DNA is the genetic material came from the experiments conducted by Alfred Hershey and Martha Chase in 1952. They used bacteriophages (viruses that infect bacteria) and radioactively labeled the protein and DNA of the phage separately in two different sets of experiments. They found that it was the DNA, not the protein, of the phage that was injected into the bacteria and carried the genetic information necessary for the production of new phage particles.
Avery, Macleoid and McCarty gave the biochemical characterisation of Transforming Principle.
The transformation experiments by using Pneumococcus was conducted by Frederick Griffith.
Wilkins and Franklin produced X-ray diffraction data of DNA.
So, the correct answer is :
Option A : Alfred Hershey and Martha Chase.
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
In eukaryotes there are three major types of RNA polymerases.
RNA polymerase I transcribes : 5.8S, 18S, 28S rRNAs
RNA polymerase II transcribes : hnRNAs (precurssor of mRNA)
RNA polymerase III transcribes : tRNAs, ScRNA, 5S rRNA and snRNA
Expressed Sequence Tags (ESTs) refers to
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
Option (C) is the correct answer because in recombinant DNA technology the separated DNA fragments can be visualised only after staining the DNA with a substance known as ethidium bromide followed by exposure to U.V. radiation. You can see bright orange coloured bands of DNA in an ethidium bromide stained gel exposed to U.V. light.
Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | Gene 'a' | (I) | -galactosidase |
| (B) | Gene 'y' | (II) | Transacetylase |
| (C) | Gene 'i' | (III) | Permease |
| (D) | Gene 'z' | (IV) | Repressor protein |
Choose the correct answer from the options given below :
Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
In prokaryotes, the negatively charged DNA is held with some positively charged proteins in a region termed as nucleoid.
In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form a structure called nucleosome.
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

Which one of the following is NOT an advantage of inbreeding?
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
Option (A) is the correct answer as, during isolation of the genetic material, purified DNA ultimately precipitates out after the addition of chilled ethanol.
Option (B) is not the answer as, proteins can be removed by treatment with proteases.
Option (D) is not the answer as RNA can be removed by treatment with ribonuclease.
In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.
Option (B) is the correct answer because in gene gun method, microparticles of tungsten or gold are used. Gold or tungsten are inert in nature so they do not alter the chemical composition of cells.
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.
A. Insertion of recombinant DNA into the host cell
B. Cutting of DNA at specific location by restriction enzyme
C. Isolation of desired DNA fragment
D. Amplification of gene of interest using PCR
Choose the correct answer from the options given below :
The correct answer is option (D) because recombinant DNA technology involves several steps in specific sequence such as isolation of DNA, fragmentation of DNA by restriction endonucleases, isolation of desired DNA fragment, ligation of the DNA fragment into a vector, transferring the recombinant DNA into the host, culturing the host cells in a medium at large scale and extraction of the desired product.
Given below are two statements:
Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II : In general, carnivores are more adversely affected by competition than herbivores.
In the light of the above statements, choose the correct answer from the options given below:
Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and the competitively inferior one will be eliminated eventually. Thus, statement I is correct.
Statement II is incorrect as in general, herbivores and plants appear to be more adversely affected by competition than carnivores.
Match List I with List II.
| List I (Interacting species) |
List II (Name of interaction) |
||
|---|---|---|---|
| (A) | A Leopard and a Lion in a forest/grassland | (I) | Competition |
| (B) | A Cuckoo laying egg in a Crow's nest | (II) | Brood parasitism |
| (C) | Fungi and root of a higher plant in Mycorrhizae | (III) | Mutualism |
| (D) | A cattle egret and a Cattle in a field | (IV) | Commensalism |
Choose the correct answer from the options given below.
Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | Logistic growth | (I) | Unlimited resource availability condition |
| (B) | Exponential growth | (II) | Limited resource availability condition |
| (C) | Expanding age pyramid | (III) | The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups |
| (D) | Stable age pyramid | (IV) | The percent individuals of pre-reproductive and reproductive age group are same |
Choose the correct answer from the options given below:
The thickness of ozone in a column of air in the atmosphere is measured in terms of :
The thickness of the ozone in a column of air from the ground to the top of the atmosphere is measured in terms of Dobson units (DU). Noise is measured in decibels.
Which of the following statements is correct?
Given below are two statements:
Statement I: Electrostatic precipitator is most widely used in thermal power plant.
Statement II : Electrostatic precipitator in thermal power plant removes ionising radiations.
In the light of the above statements, choose the most appropriate answer from the options given below:
Electrostatic precipitator is most widely used in thermal power plants.
It can remove over 99 percent particulate matter present in the exhaust from a thermal power plant.
Identify the pair of heterosporous pteridophytes among the following :
Selaginella and Salvinia are heterosporous pteridophytes. They produces two different kind of spores. Psilotum, Lycopodium and Equisetum are homosporous pteridophytes.
Given below are two statements : One labelled as Assertion A and the other labelled as Reason R:
Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from options given below:
Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period, that leads early seed production?
Which hormone promotes internode/petiole elongation in deep water rice?
The hormone that promotes internode/petiole elongation in deep water rice is Ethylene.
Ethylene is a plant hormone that plays a critical role in growth and development, including responses to environmental stimuli. In the case of deep water rice, when the plants are submerged, the ethylene concentration increases and promotes rapid internodal elongation, which allows the plant to keep its leaves above the water surface.
So, the correct answer is Option B - Ethylene.
Identify the correct statements :
A. Detrivores perform fragmentation.
B. The humus is further degraded by some microbes during mineralization.
C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.
D. The detritus food chain begins with living organisms.
E. Earthworms break down detritus into smaller particles by a process called catabolism.
Choose the correct answer from the options given below :
Let's evaluate each statement:
A. Detrivores perform fragmentation.
B. The humus is further degraded by some microbes during mineralization.
C. Water-soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.
D. The detritus food chain begins with living organisms.
E. Earthworms break down detritus into smaller particles by a process called catabolism.
Therefore, the correct answer is :
Option D : A, B, C only.
In the equation GPP R = NPP
GPP is Gross Primary Productivity
NPP is Net Primary Productivity
R here is __________.
In the equation GPP - R = NPP,
GPP stands for Gross Primary Productivity, NPP stands for Net Primary Productivity, and R represents the energy used by plants for their own metabolic processes, which is also known as Respiratory loss.
Which one of the following statements is NOT correct?
Algal bloom imparts a distinct colour to the water bodies. It causes deterioration of the water quantity and fish mortality.
Match List I with List II:
| List I (Interaction) |
List II (Species A and B) |
||
|---|---|---|---|
| (A) | Mutualism | (I) | +(A), 0(B) |
| (B) | Commensalism | (II) | (A), 0(B) |
| (C) | Amensalism | (III) | +(A), (B) |
| (D) | Parasitism | (IV) | +(A), +(B) |
Choose the correct answer from the options given below:
(+, +) Mutualism : In this interaction, both the interacting species are benefitted.
(+, 0) Commensalism : Only one species is benefitted and the other species remains unharmed.
(, 0) Amensalism : Neither species is benefitted. One remains unharmed and the other is harmed.
(+, ) Parasitism : One species is benefitted and other is negatively effected.
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
Gonorrhoea is a sexually transmitted disease caused by the bacterium Neisseria gonorrhoeae. It can be effectively treated with antibiotics, especially when detected early.
Hepatitis B, HIV Infection, and Genital Herpes are caused by viruses. These viral infections can be managed with antiviral therapy but they are typically not completely curable.
So, the correct answer is :
Option A : Gonorrhoea
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
The correct answer is option (A) because using conventional methods of diagnosis like serum and urine analysis, etc, do not help in early diagnosis. Recombinant DNA technology, Polymerase Chain Reaction [PCR] and Enzyme Linked Immuno-Sorbent Assay (ELISA) are some of the techniques that serve the purpose of early diagnosis.
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | Heroin | (I) | Effect on cardiovascular system |
| (B) | Marijuana | (II) | Slow down body function |
| (C) | Cocaine | (III) | Painkiller |
| (D) | Morphine | (IV) | Interfere with transport of dopamine |
Choose the correct answer from the options given below:
The correct answer is option (D) as
Heroin belongs to the category of opioids and it is a depressant that slows down body functions.
Marijuana is known for its effect on the cardiovascular system of the body.
Cocaine interferes with the transport of the neurotransmitter dopamine.
Morphine is used is a sedative and painkiller.
Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | Ringworm | (I) | Haemophilus influenzae |
| (B) | Filariasis | (II) | Trichophyton |
| (C) | Malaria | (III) | Wuchereria bancrofti |
| (D) | Pneumonia | (IV) | Plasmodium vivax |
Choose the correct answer from the options given below:
Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | P-wave | (I) | Beginning of systole |
| (B) | Q-wave | (II) | Repolarisation of ventricles |
| (C) | QRS complex | (III) | Depolarisation of atria |
| (D) | T-wave | (IV) | Depolarisation of ventricles |
Choose the correct answer from the options given below :
Which of the following statements are correct?
A. Basophils are most abundant cells of the total WBCs
B. Basophils secrete histamine, serotonin and heparin
C. Basophils are involved in inflammatory response
D. Basophils have kidney shaped nucleus
E. Basophils are agranulocytes
Choose the correct answer from the options given below:
The correct answer is Option B : B and C only.
Statement A is incorrect. Basophils are actually the least abundant cells of the total white blood cells (WBCs), not the most abundant.
Statement B is correct. Basophils do secrete histamine, serotonin, and heparin. Histamine and serotonin are involved in inflammatory response, while heparin is an anticoagulant.
Statement C is also correct. Basophils are involved in the inflammatory response. They release chemicals such as histamine and serotonin that dilate blood vessels and attract other white blood cells to the site of inflammation.
Statement D is incorrect. Basophils do not have a kidney-shaped nucleus. That description is more appropriate for monocytes, another type of white blood cell.
Statement E is incorrect. Basophils are not agranulocytes. They are granulocytes, a category of white blood cells characterized by the presence of granules in their cytoplasm. Agranulocytes, which lack visible cytoplasmic granules, include lymphocytes and monocytes.
Match List I with List II.
| List I (Type of Joint) |
List II (Found between) |
||
|---|---|---|---|
| (A) | Cartilaginous Joint | (I) | Between flat skull bones |
| (B) | Ball and Socket Joint | (II) | Between adjacent vertebrae in vertebral column |
| (C) | Fibrous Joint | (III) | Between carpal and metacarpal of thumb |
| (D) | Saddle joint | (IV) | Between Humerus and Pectoral girdle |
Choose the correct answer from the options given below:
A) Cartilaginous Joint : These joints are connected by cartilage and allow limited movement. They are found between adjacent vertebrae in the vertebral column.
B) Ball and Socket Joint : These joints consist of a ball-like structure fitting into a socket, allowing for a wide range of movement. They are found between the humerus and the pectoral girdle.
C) Fibrous Joint : These joints are connected by fibrous connective tissue and allow little or no movement. They are found between flat skull bones.
D) Saddle Joint : These joints have two bones with concave and convex surfaces that fit together, allowing movement in two planes. They are found between the carpal and metacarpal of the thumb.
So, the correct matching is :
A-II, B-IV, C-I, D-III
Which of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D. M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:
Option (A) is the correct answer because statements B and C are only correct statements while A and D are incorrect statements.
Muscle bundles are held together by collagenous connective tissue layer called fascia. Muscle bundles are called fascicles. The portion of the myofibril between two successive ‘Z’ lines is considered as functional unit of contraction called sarcomere.
Match List I with List II with respect to human eye.
| List I | List II | ||
|---|---|---|---|
| (A) | Fovea | (I) | Visible coloured portion of eye that regulates diameter of pupil. |
| (B) | Iris | (II) | External layer of eye formed of dense connective tissue. |
| (C) | Blind spot | (III) | Point of greatest visual acuity or resolution. |
| (D) | Sclera | (IV) | Point where optic nerve leaves the eyeball and photoreceptor cells are absent. |
Choose the correct answer from the options given below:
Option (B) is the correct answer because
(i) Fovea is the point of greatest visual acuity or resolution.
(ii) Iris is the visible coloured portion of the eye that regulates diameter of pupil.
(iii) Blind spot is the point where optic nerve leaves the eye-ball and photoreceptor cells are absent.
(iv) Sclera is the external layer of eye formed of dense connective tissue.
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are:
The limbic system, which includes structures such as the amygdala and hippocampus, plays a significant role in regulating emotions, including fear, pleasure, and anger. The hypothalamus, another component of the limbic system, is involved in various functions, including the regulation of sexual behavior and responses to pleasure and excitement. Therefore, option D is correct.
Option (A), (B) and (C) are not correct because corpora quadrigemina is a part of the midbrain and consists of four round swellings. Corpus callosum is a tract of nerve fibres that connects right and left cerebral hemispheres. Thalamus is a major coordinating centre in the forebrain for sensory and motor signalling. Midbrain, pons and medulla oblongata together form the brain stem.
Axile placentation is observed in
China rose, Tomato, Petunia and Lemon show axile placentation.
Dianthus and Primrose show free central placentation.
Pea, Lupin and Beans show marginal placentation.
Cucumber and mustard show parietal placentation.
Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R.
Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.
Reason R : Ban on amniocentesis checks increasing menace of female foeticide.
In the light of the above statements, choose the correct answer from the options given below.
The correct answer is Option C : A is false but R is true.
Assertion A is false because amniocentesis for sex determination is not a part of the Reproductive and Child Health Care Programme. In fact, the use of amniocentesis for the purpose of sex determination is illegal in many countries, including India, due to its association with sex-selective abortions and the societal preference for male children.
Reason R is true because a ban on amniocentesis for sex determination is indeed implemented in an attempt to reduce the incidence of female foeticide. The misuse of this medical procedure for sex-selective abortions has led to a gender imbalance in some societies, thus the need for regulatory measures.
Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | Vasectomy | (I) | Oral method |
| (B) | Coitus interruptus | (II) | Barrier method |
| (C) | Cervical caps | (III) | Surgical method |
| (D) | Saheli | (IV) | Natural method |
Choose the correct answer from the options given below:
A) Vasectomy : A surgical method of male sterilization that involves cutting or sealing the vas deferens to prevent sperm from entering the semen.
B) Coitus interruptus : A natural method of contraception that involves withdrawing the penis from the vagina before ejaculation to prevent sperm from entering the vagina.
C) Cervical caps : A barrier method of contraception that covers the cervix to prevent sperm from entering the uterus.
D) Saheli : An oral method of contraception that involves taking a non-steroidal, non-hormonal birth control pill.
So, the correct matching is: A-III, B-IV, C-II, D-I
Given below are two statements:
Statement I : Ligaments are dense irregular tissue.
Statement II : Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below:
The correct answer is Option A : Both Statement I and Statement II are false.
Explanation : Ligaments are a type of dense regular connective tissue, not irregular. They connect bones to other bones, providing stability and support.
On the other hand, cartilage is a type of specialized connective tissue that is not classified as dense. It's composed of cells called chondrocytes which are embedded in a matrix of collagen and elastic fibers. It's neither dense regular nor dense irregular tissue.
Therefore, both statements I and II are incorrect.
Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | Mast cells | (I) | Ciliated epithelium |
| (B) | Inner surface of bronchiole | (II) | Areolar connective tissue |
| (C) | Blood | (III) | Cuboidal epithelium |
| (D) | Tubular parts of nephron | (IV) | Specialised connective tissue |
Choose the correct answer from the options give below:
In cockroach, excretion is brought about by -
A. Phallic gland
B. Urecose gland
C. Nephrocytes
D. Fat body
E. Collaterial glands
Choose the correct answer from the options given below :
Option (B) is the answer because,
In cockroaches, excretion is primarily accomplished by Malpighian tubules, which are not listed in the provided options. However, among the provided options, urecose glands, nephrocytes, and the fat body do participate in excretory processes to some degree.
Urecose glands are present in male cockroach of some species. They synthesise uric acid. Nephrocytes are large, colourless, ovoid, binucleate cells attached to the dorsal diaphragm in the body cavity. Fat body accumulates, produces and stores uric acid.
Phallic gland is the structure of male reproductive system of cockroach and it secretes the outer layer of spermatophore. Collaterial gland is the structure of female reproductive system of cockroach and it secretes the hard egg-case or ootheca around fertilised eggs.
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
Option (A) is the correct answer because anal styles are present in male cockroaches and absent in female cockroaches.
Option (B), (C) and (D) are not the correct answers because sclerites, anal cerci and dark brown body colour are common features of both male and female cockroaches.
Match List I with List II
| List I (Cells) |
List II (Secretion) |
||
|---|---|---|---|
| (A) | Peptic cells | (I) | Mucus |
| (B) | Goblet cells | (II) | Bile juice |
| (C) | Oxyntic cells | (III) | Proenzyme pepsinogen |
| (D) | Hepatic cells | (IV) | HCl and intrinsic factor for absorption of vitamin B |
Choose the correct answer from the options given below:
Option (B) is the correct answer because gastric glands have three major types of cells namely-
(i) Mucus neck cells which secrete mucus
(ii) Peptic or chief cells which secrete the proenzyme pepsinogen
(iii) Parietal or oxyntic cells which secrete HCl and intrinsic factor for absorption of vitamin B12.
Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by
Option (A) is the correct answer because the undigested food (faeces) enters into caecum of the large intestine through ileo-caecal valve, which prevents the backflow of the faecal matter.
Option (B) is not the answer because a muscular sphincter i.e., the gastro-oesophageal sphincter regulates the opening of oesophagus into the stomach.
Option (C) is not the answer because pyloric sphincter regulates the opening in between stomach and duodenum.
Option (D) is not the answer because the opening of common hepato-pancreatic duct is guarded by sphincter of Oddi.
Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | CCK | (I) | Kidney |
| (B) | GIP | (II) | Heart |
| (C) | ANF | (III) | Gastric gland |
| (D) | ADH | (IV) | Pancreas |
Choose the correct answer from the options given below :
The correct answer is option (D) as
Cholecystokinin (CCK) acts on both gall bladder and pancreas and stimulates the secretion of bile juice and pancreatic enzymes respectively.
GIP inhibits gastric secretion and motility.
Atrial Natriuretic Factor (ANF) is released from the atrial wall of our heart.
Anti-diuretic hormone (ADH) acts mainly on the kidney and stimulates resorption of water and electrolytes by the distal tubules.
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla.
Reason R : Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.
In the light of the above statements, choose the correct answer from the options given below :
The correct answer is :
Option B : A is true but R is false.
Explanation :
Assertion A is correct. In the kidney, nephrons, the functional units responsible for filtration, reabsorption, and secretion processes, are indeed of two types: cortical and juxta-medullary. These types are classified based on their location within the kidney; cortical nephrons are primarily located in the cortex, while juxta-medullary nephrons are located near the junction between the cortex and medulla.
However, Reason R is incorrect. The assertion that juxta-medullary nephrons have short loops of Henle, while cortical nephrons have longer loops of Henle is false. In fact, it's the opposite. Juxta-medullary nephrons have longer loops of Henle which extend deep into the medulla. This allows them to concentrate urine more effectively than cortical nephrons, whose loops of Henle are shorter and do not extend as deep into the medulla.
Match List I with List II.
| List I | List II | ||
|---|---|---|---|
| (A) | Taenia | (I) | Nephridia |
| (B) | Paramoecium | (II) | Contractile vacuole |
| (C) | Periplaneta | (III) | Flame cells |
| (D) | Pheretima | (IV) | Urecose gland |
Choose the correct answer from the options given below :
The correct answer should be Option B : A-III, B-II, C-IV, D-I.
Explanation :
A) Taenia (a genus of tapeworm) has flame cells as its excretory organs.
B) Paramoecium, a unicellular protist, uses contractile vacuoles to excrete waste and excess water.
C) Periplaneta (the American cockroach) uses malpighian tubules for excretion, but "Urecose gland" is not a correct match. However, given the available options, it's the closest match.
D) Pheretima, a genus of earthworms, uses nephridia as excretory organs.
Which of the following statements are correct?
A. An excessive loss of body fluid from the body switches off osmoreceptors.
B. ADH facilitates water reabsorption to prevent diuresis.
C. ANF causes vasodilation.
D. ADH causes increase in blood pressure.
E. ADH is responsible for decrease in GFR.
Choose the correct answer from the options given below:
Option (A) is the correct answer because statements B, C and D are true statements. ADH facilitates water reabsorption from DCT of nephron to prevent diuresis, which causes increase in blood pressure. ANF which is secreted by the heart is a vasodilator.
Options (B), (C) and (D) are not correct because statements A and E are false. Excessive loss of body fluid from the body switches on the osmoreceptors.
Which of the following are NOT under the control of thyroid hormone?
A. Maintenance of water and electrolyte balance
B. Regulation of basal metabolic rate
C. Normal rhythm of sleep-wake cycle
D. Development of immune system
E. Support the process of RBCs formation
Choose the correct answer from the options given below:
Option (B) is the correct answer because thyroid hormones play an important role in the regulation of basal metabolic rate, maintenance of water and electrolyte balance and support the process of RBCs formation, whereas this hormone is not involved in regulating normal rhythm of sleep-wake cycle and development of immune system.
Which of the following statements are correct regarding female reproductive cycle?
A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Choose the most appropriate answer from the options given below:
The correct statements regarding the female reproductive cycle are :
A. In non-primate mammals cyclical changes during reproduction are called the oestrus cycle.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Statement B is incorrect because the first menstrual cycle that begins at puberty is called menarche, not menopause. Menopause is the end of the menstrual cycle and fertility in women, typically occurring in middle to old age.
So, the correct option is :
Option C : A, C and D only
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Endometrium is necessary for implantation of blastocyst.
Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.
In the light of the above statements, choose the correct answer from the options given below:
Given below are two statements:
Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.
Statement Il: The cavity of the cervix is called cervical canal which along with vagina forms birth canal.
In the light of the above statements, choose the correct answer from the options given below:
Radial symmetry is NOT found in adults of phylum ______.
Select the correct statements with reference to chordates.
A. Presence of a mid-dorsal, solid and double nerve cord.
B. Presence of closed circulatory system.
C. Presence of paired pharyngeal gill slits.
D. Presence of dorsal heart
E. Triploblastic pseudocoelomate animals.
Choose the correct answer from the options given below:
The unique mammalian characteristics are :
Vital capacity of lung is ________.
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
Option (A) is the correct answer because numbat, spotted cuscus and flying phalanger are Australian marsupials exhibiting adaptive radiation.
Option (B) is incorrect because mole and flying squirrel are placental mammals.
Option (C) is incorrect because lemur and wolf are placental mammals.
Option (D) is incorrect because bobcat is a placental mammal.
Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below: