NEET-UG 2023

NEET 2023

Physics (Maximum Marks: 200)
  • This section contains 50 questions.
  • Each question has FOUR options (A), (B), (C) and (D). ONLY ONE of these four options is the correct answer.
  • Full Marks : +4 If ONLY the correct option is chosen;
  • Zero Marks : 0 If none of the options is chosen (i.e. the question is unanswered);
  • Negative Marks : −1 In all other cases.
Q.1

The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :

(A)
Personal errors
(B)
Least count errors
(C)
Random errors
(D)
Instrumental errors
(C)

Solution

Error arise due to unpredictable fluctuation in temperature and voltage supply are random errors.

Q.2

A metal wire has mass , radius and length . The maximum possible percentage error in the measurement of density will nearly be :

(A)
1.3%
(B)
1.6%
(C)
1.4%
(D)
1.2%
(B)

Solution

Q.3

A vehicle travels half the distance with speed and the remaining distance with speed . Its average speed is :

(A)
(B)
(C)
(D)
(B)

Solution

NEET 2023 Physics - Motion in a Straight Line Question 9 English Explanation

Q.4

A bullet is fired from a gun at the speed of in the direction above the horizontal. The maximum height attained by the bullet is

:-

(A)
2000 m
(B)
1000 m
(C)
3000 m
(D)
2800 m
(B)

Solution

Q.5

A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity . The ball strikes the water surface after . The height of bridge above water surface is (Take )

(A)
60 m
(B)
64 m
(C)
68 m
(D)
56 m
(B)

Solution

NEET 2023 Physics - Motion in a Plane Question 5 English Explanation

Q.6

A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :

(A)
along northward
(B)
along north-east
(C)
along south-west
(D)
along eastward
(B)

Solution

Southward

Eastward

= Along North - East

NEET 2023 Physics - Laws of Motion Question 9 English Explanation

Q.7

Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15

.

(A)
(B)
(C)
(D)
(B)

Solution

To find the maximum acceleration () of the car that allows a body to stay stationary relative to the car, we use the concept of static friction. Static friction () is what keeps the body from sliding on the car's floor. It acts in the opposite direction of the potential movement of the body.

The maximum static friction force is given by where is the coefficient of static friction and is the normal force. In this scenario, the normal force is equal to the gravitational force on the body (), where is the mass of the body and is the acceleration due to gravity.

Since the maximum force of static friction equals the product of the mass and the maximum acceleration (), we have:

By canceling out the mass on both sides, we get:

Substituting the given values ( and ):

Therefore, the maximum acceleration of the car to ensure the body remains stationary with respect to the car's floor is .

Q.8

A bullet from a gun is fired on a rectangular wooden block with velocity . When bullet travels through the block along its length horizontally, velocity of bullet becomes . Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is :

(A)
(B)
(C)
(D)
(D)

Solution

..... (1)

Similarly from starting

..... (2)

Q.9

The potential energy of a long spring when stretched by is U. If the spring is stretched by , potential energy stored in it will be :

(A)
4U
(B)
8U
(C)
16U
(D)
2U
(C)

Solution

The potential energy (U) stored in a spring when it is stretched or compressed is given by the formula:

where:

  • is the spring constant,
  • is the displacement from the spring's equilibrium position (i.e., how much the spring is stretched or compressed).

If the spring is initially stretched by cm (or meters, since we generally use SI units for these calculations), the potential energy stored can be represented as:

When the spring is stretched by cm (or meters), the new potential energy becomes:

To find the relation between and , we can divide the expression for by that of :

Simplifying this quotient gives:

Thus, if the spring's displacement is increased from cm to cm, the potential energy stored in the spring increases by a factor of , meaning:

Q.10

The ratio of radius of gyration of a solid sphere of mass and radius about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :-

(A)
(B)
(C)
(D)
(D)

Solution

To solve this problem, we need to find the ratio of the radius of gyration for a solid sphere (K₁) to the radius of gyration for a thin hollow sphere (K₂) of the same mass M and radius R.

The moment of inertia (I) of a solid sphere about its own axis is given by :

The radius of gyration (K) is related to the moment of inertia (I) and mass (M) by the formula :

So for the solid sphere, we can find K₁ using :



Now, for a thin hollow sphere, the moment of inertia about its axis is given by :

We can find K₂ using :



Now, we need to find the ratio K₁ : K₂ :

The R terms cancel out, and we are left with :

Simplify by taking the square root of the fraction :

Now, the square root of 2 terms cancel out, giving us :

Q.11

The angular acceleration of a body, moving along the circumference of a circle, is :

(A)
along the radius towards the centre
(B)
along the tangent to its position
(C)
along the axis of rotation
(D)
along the radius, away from centre
(C)

Solution

NEET 2023 Physics - Rotational Motion Question 14 English Explanation

Along the axis of rotation.

Q.12

Two bodies of mass and are placed at a distance . The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be ( gravitational constant) :

(A)
(B)
(C)
(D)
(B)

Solution

NEET 2023 Physics - Gravitation Question 13 English Explanation

Position of Neutral point (Zero Gravitational Field)

Now Gravitational potential at point

Q.13

A satellite is orbiting just above the surface of the earth with period . If is the density of the earth and is the universal constant of gravitation, the quantity represents :

(A)
(B)
(C)
(D)
(A)

Solution

For a satellite orbiting just above the surface of the Earth, we can use the formula for the period T of the satellite in terms of the Earth's density d and the gravitational constant G:

where a is the semi-major axis of the orbit (which is approximately equal to the Earth's radius R for a satellite orbiting just above the surface) and M is the mass of the Earth.

We can express the mass of the Earth M in terms of its density d and volume:

Now, substitute this expression for M into the equation for T:

Since the satellite is orbiting just above the Earth's surface, we can approximate a ≈ R:

Simplify the equation:

Now, square both sides of the equation:

Simplify further:

Thus, the quantity represents .

Q.14

The amount of energy required to form a soap bubble of radius from a soap solution is nearly: (surface tension of soap solution )

(A)
(B)
(C)
(D)
(B)

Solution

Q.15

The venturi-meter works on :

(A)
Bernoulli's principle
(B)
The principle of parallel axes
(C)
The principle of perpendicular axes
(D)
Huygen's principle
(A)

Solution

A venturi meter is a device used to measure the flow rate of a fluid through a pipe. The venturi meter works on Bernoulli's principle, which states that for an incompressible, non-viscous fluid flowing through a pipe, the sum of the pressure energy, kinetic energy, and potential energy per unit volume remains constant.
Q.16

Let a wire be suspended from the ceiling (rigid support) and stretched by a weight attached at its free end. The longitudinal stress at any point of cross-sectional area of the wire is :

(A)
(B)
(C)
Zero
(D)
(A)

Solution

When a wire is suspended from the ceiling and stretched by a weight W attached at its free end, the force acting on the wire is equal to the weight W. This force causes longitudinal stress in the wire.

Longitudinal stress is defined as the force acting on an object divided by its cross-sectional area. In this case, the force acting on the wire is W, and the cross-sectional area of the wire is A.

Thus, the longitudinal stress at any point of the wire with cross-sectional area A is given by :

Q.17

The temperature of a gas is . To what temperature the gas should be heated so that the rms speed is increased by times?

(A)
(B)
(C)
(D)
(A)

Solution

let initial speed is

As speed is increased by times so final speed become

So temp. in

Q.18

A Carnot engine has an efficiency of when its source is at a temperature . The temperature of the sink is :-

(A)
(B)
(C)
(D)
(D)

Solution

Efficiency of carnot engine

So temp. of sink is

Q.19

The - graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at is :

NEET 2023 Physics - Oscillations Question 13 English

(A)
(B)
(C)
(D)
(C)

Solution

Q.20

The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is

(A)
(B)
(C)
(D)
(A)

Solution

The fundamental frequency of an open pipe, noop, is given by V / (2L), where V is the speed of sound and L is the length of the pipe.

For a closed pipe of the same length, the fundamental frequency, ncop, is V / (4L) since only half as many wavelengths fit into the same length due to the closed end.

Therefore, the ratio of frequencies of an open pipe to a closed pipe is:

This shows that the fundamental frequency of an open pipe is twice that of a closed pipe of the same length.

Q.21

An electric dipole is placed at an angle of with an electric field of intensity . It experiences a torque equal to . Calculate the magnitude of charge on the dipole, if the dipole length is .

(A)
6 mC
(B)
4 mC
(C)
2 mC
(D)
8 mC
(C)

Solution

The torque τ experienced by an electric dipole in an electric field is given by the formula:

where p is the electric dipole moment, E is the electric field intensity, and θ is the angle between the dipole and the electric field. The electric dipole moment p can be expressed as:

where q is the charge on the dipole, and d is the dipole length.

We are given the following values:

  • Torque τ = 4 N·m
  • Electric field intensity E =
  • Angle θ =
  • Dipole length d = 2 cm = 0.02 m

We need to find the charge q on the dipole. Let's first solve for the electric dipole moment p:



Substituting the given values:

Now, let's solve for the charge q using the formula:



Substituting the values for p and d:

So, the magnitude of the charge on the dipole is 2 mC.

Q.22

If \oint_\limits{s} \vec{E} \cdot \overrightarrow{d S}=0 over a surface, then:

(A)
the magnitude of electric field on the surface is constant.
(B)
all the charges must necessarily be inside the surface.
(C)
the electric field inside the surface is necessarily uniform.
(D)
the number of flux lines entering the surface must be equal to the number of flux lines leaving it.
(D)

Solution

So,

NEET 2023 Physics - Electrostatics Question 15 English Explanation

Number of field lines entering is equal number of field lines leaving.

Q.23

An electric dipole is placed as shown in the figure.

NEET 2023 Physics - Electrostatics Question 16 English

The electric potential (in 102 V) at point P due to the dipole is ( = permittivity of free space and = K) :

(A)
(B)
(C)
(D)
(D)

Solution

NEET 2023 Physics - Electrostatics Question 16 English Explanation

Q.24

The magnitude and direction of the current in the following circuit is :-

NEET 2023 Physics - Current Electricity Question 20 English

(A)
0.5 A from to through
(B)
from to through
(C)
1.5 A from to through
(D)
0.2 A from to through
(A)

Solution

NEET 2023 Physics - Current Electricity Question 20 English Explanation

from to through .

Q.25

If the galvanometer does not show any deflection in the circuit shown, the value of is given by:

NEET 2023 Physics - Current Electricity Question 22 English

(A)
50
(B)
100
(C)
400
(D)
200
(B)

Solution

For no reading galvanometer. Potential across it is same.

NEET 2023 Physics - Current Electricity Question 22 English Explanation

Q.26

Resistance of a carbon resistor determined from colour codes is . The colour of third band must be :

(A)
Green
(B)
Orange
(C)
Yellow
(D)
Red
(B)

Solution

Acc. to color code

Third Band Orange

(color code for digit 3 is orange)

Q.27

The resistance of platinum wire at is and at . The temperature coefficient of resistance of the wire is :

(A)
(B)
(C)
(D)
(B)

Solution

Q.28

10 resistors, each of resistance are connected in series to a battery of emf and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased times. The value of is :

(A)
100
(B)
1
(C)
1000
(D)
10
(A)

Solution

..... (1)

.... (2)

Q.29

The equivalent capacitance of the system shown in the following circuit is:

NEET 2023 Physics - Capacitor Question 12 English

(A)
3F
(B)
6F
(C)
9F
(D)
2F
(D)

Solution

NEET 2023 Physics - Capacitor Question 12 English Explanation

Q.30

A wire carrying a current along the positive -axis has length . It is kept in a magnetic field . The magnitude of the magnetic force acting on the wire is :

(A)
(B)
(C)
IL
(D)
3 IL
(B)

Solution

Q.31

A very long conducting wire is bent in a semi-circular shape from to as shown in figure. The magnetic field at point for steady current configuration is given by :

NEET 2023 Physics - Moving Charges and Magnetism Question 13 English

(A)
pointed away from the page
(B)
pointed away from page
(C)
pointed into the page
(D)
pointed into the page
(B)

Solution

outward i.e. away from page.

Q.32

The net magnetic flux through any closed surface is :

(A)
Positive
(B)
Infinity
(C)
Negative
(D)
Zero
(D)

Solution

Magnetic field exist in

Closed Loops (Monopoles do not exist)

(Gauss law for magnetism)

Q.33

In a series LCR circuit, the inductance is , capacitance is and resistance is . The frequency at which resonance occurs is :-

(A)
15.9 kHz
(B)
1.59 rad/s
(C)
1.59 kHz
(D)
15.9 rad/s
(C)

Solution

The goal is to find the frequency at which resonance occurs in a series LCR circuit. To achieve resonance, the inductive reactance () should equal the capacitive reactance ().

Given are:

  • Inductance,
  • Capacitance,
  • Resistance, (which does not directly impact the resonance frequency)

Resonance occurs when the angular frequency () meets the condition , leading to the formula for calculating the resonance frequency () as .

Substituting the given values:

Thus, the frequency at which resonance occurs in this LCR circuit is 1.59 kHz.

Q.34

A lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of . Assuming the transformer to be ideal, what is the current in the primary winding ?

(A)
2.7 A
(B)
3.7 A
(C)
0.37 A
(D)
0.27 A
(D)

Solution

To find the current in the primary winding of an ideal step-down transformer, we first understand that an ideal transformer's power input (primary side) equals its power output (secondary side). This is because an ideal transformer is assumed to have 100% efficiency, meaning there are no losses in the transformation process.

The power of the lamp (which is connected to the secondary side of the transformer) is given as , and it operates at . The voltage on the primary side of the transformer is .

Using the power formula , where is the power in watts, is the current in amperes, and is the voltage in volts, we equate the power on both sides of the transformer because of its ideal nature, i.e., .

Hence, .

Solving for gives:

.

Therefore, the current in the primary winding of the transformer is approximately .

Q.35

An ac source is connected to a capacitor C. Due to decrease in its operating frequency

(A)
displacement current increases.
(B)
displacement current decreases.
(C)
capacitive reactance remains constant.
(D)
capacitive reactance decreases.
(B)

Solution

When an AC source is connected to a capacitor, the current (I) depends on the capacitive reactance (XC), where , with representing the angular frequency , and C denoting the capacitance.

The formula for capacitive reactance shows that it is inversely proportional to the frequency (f) of the operation.

Thus, if the frequency decreases, the capacitive reactance increases because and is proportional to frequency.

As capacitive reactance increases, the displacement current (I), which flows through the capacitor, decreases according to the relationship , with V being the voltage across the capacitor.

So, among the given choices, the correct interpretation is that the displacement current decreases with a decrease in operating frequency.

Q.36

The magnetic energy stored in an inductor of inductance carrying a current of is :

(A)
(B)
(C)
(D)
(C)

Solution

The formula for calculating the magnetic energy stored in an inductor is given by:

where:

  • is the energy stored (in joules, J),
  • is the inductance of the inductor (in henrys, H),
  • is the current flowing through the inductor (in amperes, A).

Plugging the given values into the formula:

Hence, the energy stored in the inductor is .

Q.37

The net impedance of circuit (as shown in figure) will be :

NEET 2023 Physics - Alternating Current Question 15 English

(A)
(B)
(C)
(D)
(B)

Solution

To find the net impedance, Z, of the circuit, we need to calculate the inductive reactance (XL), the capacitive reactance (XC), and use the resistance (R) in the circuit. Since R is given as 10 , we calculate the reactances as follows:

Inductive reactance, , where is the frequency and is the inductance. With Hz and given as mH, or H, we find .

Capacitive reactance, , where is the capacitance. Given μF, or F, results in .

With these values, the net impedance of the circuit can be calculated using the formula:

Substituting , , and , we find:

Therefore, the correct option is .

Q.38

In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of and amplitude . Then the amplitude of oscillating magnetic field is : (Speed of light in free space )

(A)
(B)
(C)
(D)
(B)

Solution

Q.39

Light travels a distance in time in air and in time in another denser medium. What is the critical angle for this medium?

(A)
(B)
(C)
(D)
(C)

Solution

The critical angle, denoted as , is the angle of incidence beyond which light is totally internally reflected within a denser medium when it hits the boundary with a less dense medium. To find the critical angle for the medium in question, first, we need to understand the relationship between the speed of light in different media and their refractive indices.

Let's denote the speed of light in air as and in the denser medium as . From the given information:

(speed of light in air)

(speed of light in the denser medium)

The refractive index of a medium (n) is inversely proportional to the speed of light in that medium (, where c is the speed of light in vacuum). Thus, the refractive index of the denser medium () relative to air () can be obtained by taking the ratio of the speed of light in air to that in the denser medium:

Substituting the expressions for and :

For the critical angle , the light in the denser medium (index ) strikes the boundary with the less dense medium (index ) such that it refracts at 90 degrees (escapes along the boundary). Snell's Law at this boundary is:

Given that (approximating the refractive index of air), we simplify to:

Substituting from the earlier relation and simplifying:

Hence, the critical angle is given by:

Q.40

In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin) ?

NEET 2023 Physics - Geometrical Optics Question 16 English

(A)
(B)
(C)
(D)
(B)

Solution

NEET 2023 Physics - Geometrical Optics Question 16 English Explanation

Use

Q.41

Two thin lenses are of same focal lengths , but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :

(A)
(B)
(C)
Infinite
(D)
Zero
(C)

Solution

Q.42

For Young's double slit experiment, two statements are given below :

Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains constant.

Statement II : If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.

In the light of the above statements, choose the correct answer from the options given below :

(A)
Both Statement I and Statement II are false
(B)
Statement I is true but Statement II is false
(C)
Statement I is false but Statement II is true
(D)
Both Statement I and Statement II are true
(B)

Solution

In Young's double slit experiment, the angular separation of the fringes (θ) is given by :

where m is the fringe order, λ is the wavelength of the light, and d is the distance between the slits.

Now, let's analyze both statements:

Statement I: If the screen is moved away from the plane of the slits, the angular separation of the fringes remains constant.

This statement is true because the angular separation of the fringes (θ) does not depend on the distance between the screen and the slits. It only depends on the fringe order (m), the wavelength of the light (λ), and the distance between the slits (d).

Statement II: If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.

This statement is false because if the wavelength (λ) increases, the angular separation of the fringes (θ) also increases according to the formula :

So, the correct answer is :

Option B: Statement I is true but Statement II is false.

Q.43

The half life of a radioactive substance is 20 minutes. In how much time, the activity of substance drops to of its initial value?

(A)
40 minutes
(B)
60 minutes
(C)
80 minutes
(D)
20 minutes
(C)

Solution

Half life

Left fraction of activity

Q.44

In hydrogen spectrum, the shortest wavelength in the Balmer series is . The shortest wavelength in the Bracket series is :

(A)
(B)
(C)
(D)
(A)

Solution

Shortest wavelength in Balmer series when transition of from to

.... (1)

Shortest wavelength is Bracket series when transition of from to

..... (2)

Eq. (1) / Eq. (2)

Q.45

The radius of inner most orbit of hydrogen atom is . What is the radius of third allowed orbit of hydrogen atom?

(A)
1.06
(B)
1.59
(C)
4.77
(D)
0.53
(C)

Solution

The formula to calculate the radius of the nth orbit in a hydrogen atom is given by the equation:

where,
is the radius of the nth orbit,
is the radius of the innermost orbit (known as the Bohr radius), and
is the orbit number.

Given that the radius of the innermost orbit () is or equivalently , and we're interested in finding the radius of the third orbit ().

So,

Therefore, the radius of the third allowed orbit of the hydrogen atom is 4.77 .

Q.46

The work functions of Caesium , potassium and Sodium (Na) are and respectively. If incident electromagnetic radiation has an incident energy of , which of these photosensitive surfaces may emit photoelectrons?

(A)
Both Na and K
(B)
K only
(C)
Na only
(D)
Cs only
(D)

Solution

Given energy of photon

Work function of

We know that emitts when

here it is clear that energy of photon is more than the work function of [Caesium] only so Ans. only (Cs).

Q.47

The minimum wavelength of -rays produced by an electron accelerated through a potential difference of volts is proportional to :

(A)
(B)
(C)
(D)
(A)

Solution

The minimum wavelength, , of X-rays produced by an electron can be determined using the equation derived from the energy of a photon and the energy given to an electron by an accelerating voltage, .

The energy of a photon is given by , where is Planck's constant, is the speed of light, and is the wavelength of the photon.

When an electron is accelerated through a potential difference of volts, it gains kinetic energy equal to , where is the electron charge.

This energy is then converted into a photon's energy when the electron collides with a target in an X-ray tube, resulting in X-rays of wavelength . Setting the kinetic energy equal to the photon energy gives . Solving for gives .

Therefore, the minimum wavelength (corresponding to the maximum energy photon produced when all the kinetic energy is converted into photon energy) is inversely proportional to the voltage, .

Thus, .

Q.48

Given below are two statements:

Statement I : Photovoltaic devices can convert optical radiation into electricity.

Statement II : Zener diode is designed to operate under reverse bias in breakdown region.

In the light of the above statements, choose the most appropriate answer from the options given below :

(A)
Both Statement I and Statement II are incorrect.
(B)
Statement I is correct but Statement II is incorrect.
(C)
Statement I is incorrect but Statement II is correct.
(D)
Both Statement I and Statement II are correct
(D)

Solution

Statement I : Photocell/solar cell convert light energy into electric energy/current.

Statement II : We use zener diode in reverse biased condition, when reverse biased voltage more than break down voltage than it act as stablizer.

Q.49

A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?

(A)
p-n junction diodes
(B)
Capacitor
(C)
Load resistance
(D)
A centre-tapped transformer
(B)

Solution

Capacitor used to remove AC ripples from Rectifier output.

Q.50

For the following logic circuit, the truth table is:

NEET 2023 Physics - Semiconductor Electronics Question 20 English

(A)
A B Y
0 0 0
0 1 1
1 0 1
1 1 1
(B)
A B Y
0 0 1
0 1 0
1 0 1
1 1 0
(C)
A B Y
0 0 0
0 1 0
1 0 0
1 1 1
(D)
A B Y
0 0 1
0 1 1
1 0 1
1 1 0
(A)

Solution

Gate

A B Y
0 0 0
0 1 1
1 0 1
1 1 1

Chemistry (Maximum Marks: 200)
  • This section contains 50 questions.
  • Each question has FOUR options (A), (B), (C) and (D). ONLY ONE of these four options is the correct answer.
  • Full Marks : +4 If ONLY the correct option is chosen;
  • Zero Marks : 0 If none of the options is chosen (i.e. the question is unanswered);
  • Negative Marks : −1 In all other cases.
Q.1

The right option for the mass of produced by heating of pure limestone is

(Atomic mass of )

(A)
1.76 g
(B)
2.64 g
(C)
1.32 g
(D)
1.12 g
(A)

Solution

Weight of impure limestone

Weight of pure limestone of

Image

Q.2

Select the correct Statements from the following :

A. Atoms of all elements are composed of two fundamental particles.

B. The mass of the electron is .

C. All the isotopes of a given elements show same chemical properties.

D. Protons and electrons are collectively known as nucleons.

E. Dalton's atomic theory, regarded the atom as an ultimate particle of matter.

Choose the correct answer from the options given below.

(A)
C, D and E only
(B)
A and E only
(C)
B, C and E only
(D)
A, B and C only
(C)

Solution

It is statement based question.

Statements B, C & E are correct.

(B) Mass of the electron is

(C) All the isotopes of given elements show same chemical properties.

(E) Dalton's atomic theory, regarded the atom as an ultimate particle of matter.

Q.3

The relation between the number of permissible values of magnetic quantum number ) for a given value of azimuthal quantum number , is

(A)
(B)
(C)
(D)
(D)

Solution

Sol. Number of permissible values of magnetic quantum number for a given value of azimuthal quantum

Q.4

On balancing the given redox reaction,

the coefficients and are found to be, respectively -

(A)
3, 8, 1
(B)
1, 8, 3
(C)
8, 1, 3
(D)
1, 3, 8
(D)

Solution

Reaction has to be balanced in acidic medium 'O' atoms are balanced by adding and then -atom is balanced by adding ions and charge is balanced by .

Oxidation:

Reduction:

Q.5

Which amongst the following options is correct graphical representation of Boyle's law?

(A)
NEET 2023 Chemistry - Gaseous State Question 3 English Option 1
(B)
NEET 2023 Chemistry - Gaseous State Question 3 English Option 2
(C)
NEET 2023 Chemistry - Gaseous State Question 3 English Option 3
(D)
NEET 2023 Chemistry - Gaseous State Question 3 English Option 4
(A)

Solution

Boyle's law is defined at constant temperature for an ideal gas.

[straight line equation]

slope of P versus curve is

Slope

Q.6

The equilibrium concentrations of the species in the reaction are and , respectively at for the reaction is

(A)
(B)
(C)
(D)
(B)

Solution

Q.7

Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?

(A)
(B)
(C)
(D)
(A)

Solution

Q.8

The conductivity of centimolar solution of at is and the resistance of the cell containing the solution at is . The value of cell constant is -

(A)
(B)
(C)
(D)
(B)

Solution

Centimolar solution

Conductivity

Resistance

Q.9

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:

Assertion A : In equation , value of depends on n.

Reason R : is an intensive property and is an extensive property.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both A and R are true but R is NOT the correct explanation of A.
(B)
A is true but R is false.
(C)
A is false but R is true.
(D)
Both A and R are true and R is the correct explanation of A.
(D)

Solution

is an intensive property and is an extensive property as it depends on number of transferred in cell reaction.

Q.10

For a certain reaction, the rate , when the initial concentration of A is tripled keeping concentration of constant, the initial rate would

(A)
increase by a factor of six
(B)
increase by a factor of nine
(C)
increase by a factor of three
(D)
decrease by a factor of nine
(B)

Solution

Rate

If is tripled and is kept constant.

Increased by a factor of nine

Q.11

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.

Assertion A : A reaction can have zero activation energy.

Reason R : The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both A and R are true but R is NOT the correct explanation of A.
(B)
A is true but R is false.
(C)
A is false but R is true.
(D)
Both A and R are true and R is the correct explanation of A.
(C)

Solution

A reaction cannot have zero activation energy.

is minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value.

Q.12

A compound is formed by two elements A and B. The elements B forms cubic close packed structure and atoms of A occupy of tetrahedral voids. If the formula of the compound is , then the value of is in option

(A)
4
(B)
3
(C)
2
(D)
5
(D)

Solution

NEET 2023 Chemistry - Solid State Question 4 English Explanation

Q.13

What fraction of one edge centred octahedral void lies in one unit cell of fcc?

(A)
(B)
(C)
(D)
(B)

Solution

Edge centred octahedral void is shared between four unit cells

Per unit cell contribution is 1/4

Q.14

Which one is an example of heterogenous catalysis?

(A)
Hydrolysis of sugar catalysed by ions.
(B)
Decomposition of ozone is presence of nitrogen monoxide.
(C)
Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron.
(D)
Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen.
(C)

Solution

(1) (Homogeneous reaction)

(2) (Homogeneous reaction)

(3) (Reactants and catalyst are in different phase) It is heterogeneous reaction

(4)

Q.15

Pumice stone is an example of -

(A)
gel
(B)
solid sol
(C)
foam
(D)
sol
(B)

Solution

Pumice stone is an example of solid state

Q.16

Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is

:

(A)
2
(B)
4
(C)
1
(D)
3
(D)

Solution

Total number of species = 3

NEET 2023 Chemistry - Chemical Bonding and Molecular Structure Question 24 English Explanation

Q.17

The correct order of energies of molecular orbitals of molecule, is

(A)
(B)
(C)
(D)
(D)

Solution

Molecular orbital (energy) diagram / sequence of N

NEET 2023 Chemistry - Chemical Bonding and Molecular Structure Question 22 English Explanation

Q.18

Taking stability as the factor, which one of the following represents correct relationship?

(A)
InI > lnI
(B)
AlCl > AlCl
(C)
TlI > TlI
(D)
TlCl > TlCl
(C)

Solution

T & I > T & 3I

due to inert pair effect T is more stable than T.

Q.19

Intermolecular forces are forces of attraction and repulsion between interacting particles that will include:

A. dipole - dipole forces.

B. dipole - induced dipole forces

C. hydrogen bonding

D. covalent bonding

E. dispersion forces

Choose the most appropriate answer from the options given below :

(A)
A, B, C, D are correct
(B)
A, B, C, E are correct
(C)
A, C, D, E are correct
(D)
B, C, D, E are correct
(B)

Solution

Intermolecular forces means force of attraction between two or more molecules

dipole-dipole (attraction between two or more polar molecules).

Dipole induced dipole (attraction between polar and non polar molecules)

Hydrogen bonding (it is a special type of dipole-dipole and ion-dipole attraction)

Dispersion forces (mainly acts between non polar molecules).

Covalent bonding (acts between atom not between molecules )

Q.20

The reaction that does NOT take place in blast furnace between 900 K to 1500 K temperature range during extraction of iron is :

(A)
(B)
(C)
(D)
(D)

Solution

Reaction

This reaction takes place at temperature (500 K - 800 K) not at (900 K to 1500 K)

Q.21

Given below are two statements : one is labelled as Assertion and the other is labelled as Reason :

Assertion A : Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.

Reason R : The deep blue solution is due to the formation of amide.

In the light of the above statements, choose the correct answer from the options given below :

(A)
Both and are true but is NOT the correct explanation of .
(B)
is true but is false
(C)
is false but is true
(D)
Both and are true and is the correct explanation of .
(B)

Solution

Assertion is correct because all Alkali metals gives deep blue solution by giving electrons.

Reason is incorrect because deep blue solution appears due to the presence of ammoniated electron or solvated electrons.

Q.22

Which one of the following statements is correct?

(A)
All enzymes that utilise ATP in phosphate transfer require as the cofactor.
(B)
The bone in human body is an inert and unchanging substance.
(C)
plays roles in neuromuscular function and interneuronal transmission.
(D)
The daily requirement of and in the human body is estimated to be 0.2 - 0.3 .
(D)

Solution

The daily requirement in the human body has been estimated to be 200-300 mg (NCERT : s-block) Biological importance of magnesium and calcium.

Q.23

Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in presence of calcium oxide is :

(A)
32
(B)
30
(C)
18
(D)
16
(A)

Solution

NEET 2023 Chemistry - s-Block Elements Question 4 English Explanation

Weight g

Q.24

Which of the following statements are NOT correct?

A. Hydrogen is used to reduce heavy metal oxides to metals.

B. Heavy water is used to study reaction mechanism.

C. Hydrogen is used to make saturated fats from oils

D. The bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element.

E. Hydrogen reduces oxides of metals that are more active than iron.

Choose the most appropriate answer from the options given below:

(A)
B, D only
(B)
D, E only
(C)
A, B, C only
(D)
B, C, D, E only
(B)

Solution

(D, E) explanation

(D) bond strength/ bond dissociation energy/bond energy of can not be lowest because bond formed between hydrogen atoms is due to overlapping of -.

(E) Hydrogen can not reduces oxides of highly reactive metal.

Q.25

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R.

Assertion A : Helium is used to dilute oxygen in diving apparatus.

Reason R : Helium has high solubility in O.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both A and R are true but R is NOT the correct explanation of A.
(B)
A is true but R is false.
(C)
A is false but R is true.
(D)
Both A and R are true and R is the correct explanation of A.
(B)

Solution

Assertion is true because He has low solubility in blood. (NCERT)

Q.26

Match List I with List II:

List I
List II
(A) Coke (I) Carbon atoms are sp hybridised
(B) Diamond (II) Used as a dry lubricant
(C) Fullerene (III) Used as a reducing agent
(D) Graphite (IV) Cage like molecules

Choose the correct answer from the options given below:

(A)
A-IV, B-I, C-II, D-III
(B)
A-III, B-I, C-IV, D-II
(C)
A-III, B-IV, C-I, D-II
(D)
A-II, B-IV, C-I, D-III
(B)

Solution

Coke : It is used as reducing agent in carbon reduction methods. (in metallurgical process)

Diamond : It is a allotrope of carbon in which each carbon is hybridised.

NEET 2023 Chemistry - p-Block Elements Question 13 English Explanation

Fullerene : It contains pentagonal & hexagonal rings (cage like structure)

Graphite : It is soft solid because graphite layers are bonded with weak Vander Wall attractions.

Q.27

The element expected to form largest ion to achieve the nearest noble gas configuration is

(A)
(B)
(C)
(D)
(B)

Solution

all ions are isoelectronic containing

order of radius

Nitrogen to achieve Noble gas configuration it gain , & form

Q.28

Match List I with List II:

List I
(Oxoacids of Sulphur)
List II
(Bonds)
(A) Peroxodisulphuric acid (I) Two S-OH, Four S=O, One S-O-S
(B) Sulphuric acid (II) Two S-OH, One S=O
(C) Pyrosulphuric acid (III) Two S-OH, Four S=O, One S-O-O-S
(D) Sulphurous acid (IV) Two S-OH, Two S=O

Choose the correct answer from the options given below:

(A)
A-III, B-IV, C-I, D-II
(B)
A-I, B-III, C-IV, D-II
(C)
A-III, B-IV, C-II, D-I
(D)
A-I, B-III, C-II, D-IV
(A)

Solution

NEET 2023 Chemistry - p-Block Elements Question 15 English Explanation
Q.29

The stability of is more than salts in aqueous solution due to -

(A)
enthalpy of atomization.
(B)
hydration energy.
(C)
second ionisation enthalpy.
(D)
first ionisation enthalpy.
(B)

Solution

NEET 2023 Chemistry - d and f Block Elements Question 21 English Explanation

is more stable than because released hydration energy is more in case of than .

Q.30

Which of the following statements are INCORRECT?

A. All the transition metals except scandium form MO oxides which are ionic.

B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in to .

C. Basic character increases from to to .

D. dissolves in acids to give salts.

E. is basic but is amphoteric.

Choose the correct answer from the options given below:

(A)
B and D only
(B)
C and D only
(C)
B and C only
(D)
A and E only
(B)

Solution

NEET 2023 Chemistry - d and f Block Elements Question 20 English Explanation

dissolve in acid to give salts. This doesn't shown by

Q.31

Homoleptic complex from the following complexes is :

(A)
Diamminechloridonitrito-N-platinum (II)
(B)
Pentaamminecarbonatocobalt (III) chloride
(C)
Triamminetriaquachromium (III) chloride
(D)
Potassium trioxalatoaluminate (III)
(D)

Solution

(1)

(2)

(3)

(4)

Option 4 contain all ligands are of same type i.e. why complex will be homoleptic.

Q.32

Which complex compound is most stable?

(A)
(B)
(C)
(D)
(B)

Solution

due to Chelation effect of (en).

Q.33

Given below are two statements:

Statement I : The nutrient deficient water bodies lead to eutrophication.

Statement II : Eutrophication leads to decrease in the level of oxygen in the water bodies.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are false
(B)
Statement I is correct but Statement II is false.
(C)
Statement I is incorrect but Statement II is true.
(D)
Both Statement I and Statement II are true.
(C)

Solution

The correct answer is Option C : Statement I is incorrect but Statement II is true.

Statement I is incorrect. Eutrophication is not caused by nutrient-deficient water bodies, but rather by nutrient-rich water bodies. This process typically occurs when a body of water becomes overly enriched with nutrients (like phosphates and nitrates), often due to runoff from the land, which causes a dense growth of plant life, particularly algae blooms.

Statement II is true. The excessive plant growth and algal blooms caused by eutrophication can deplete the oxygen levels in the water when these organisms die and decompose. This can lead to the death of animal life, particularly fish, in the affected water body, a condition known as hypoxia.

Q.34

The number of bonds, bonds and lone pair of electrons in pyridine, respectively are:

(A)
12, 3, 0
(B)
11, 3, 1
(C)
12, 2, 1
(D)
11, 2, 0
(B)

Solution

NEET 2023 Chemistry - Some Basic Concepts of Organic Chemistry Question 25 English Explanation

Q.35

In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with due to the formation of-

(A)
NaSCN
(B)
(C)
(D)
(C)

Solution

Sol. In case nitrogen and sulphur both are present in an organic compound, sodium thiocyanate is formed, it give blood red colour and no prussian blue since there are no free cyanide Ions

Blood red

Q.36

Amongst the given options which of the following molecules/ion acts as a Lewis acid?

(A)
(B)
(C)
(D)
(B)

Solution

NEET 2023 Chemistry - Some Basic Concepts of Organic Chemistry Question 23 English Explanation

can not act as lewis acid because they does not contain vacant orbital

BF Contains vacant orbital on central atom (Boron).

Q.37

Consider the following compounds/species:

NEET 2023 Chemistry - Some Basic Concepts of Organic Chemistry Question 24 English

The number of compounds/species which obey Huckel's rule is ___________.

(A)
6
(B)
2
(C)
5
(D)
4
(D)

Solution

Huckle's rule = (4n + 2) electrons

Comp (i), (ii), (v), (vii) obey Huckle's rule

Q.38

Identify product is the following reaction :

NEET 2023 Chemistry - Hydrocarbons Question 10 English

(A)
NEET 2023 Chemistry - Hydrocarbons Question 10 English Option 1
(B)
NEET 2023 Chemistry - Hydrocarbons Question 10 English Option 2
(C)
NEET 2023 Chemistry - Hydrocarbons Question 10 English Option 3
(D)
NEET 2023 Chemistry - Hydrocarbons Question 10 English Option 4
(D)

Solution

NEET 2023 Chemistry - Hydrocarbons Question 10 English Explanation
Q.39

The given compound

NEET 2023 Chemistry - Haloalkanes and Haloarenes Question 11 English

is an example of _________.

(A)
aryl halide
(B)
allylic halide
(C)
vinylic halide
(D)
benzylic halide
(B)

Solution

NEET 2023 Chemistry - Haloalkanes and Haloarenes Question 11 English Explanation
Q.40

Consider the following reaction and identify the product (P).

NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 10 English

(A)
(B)
NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 10 English Option 2
(C)
NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 10 English Option 3
(D)
NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 10 English Option 4
(D)

Solution

NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 10 English Explanation
Q.41

Consider the following reaction

NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 12 English

Identify products A and B :-

(A)
NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 12 English Option 1
(B)
NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 12 English Option 2
(C)
NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 12 English Option 3
(D)
NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 12 English Option 4
(B)

Solution

NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 12 English Explanation
Q.42

Which amongst the following will be most readily dehydrated under acidic conditions?

(A)
NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 11 English Option 1
(B)
NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 11 English Option 2
(C)
NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 11 English Option 3
(D)
NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 11 English Option 4
(A)

Solution

Due to presence of conjugation in product.

NEET 2023 Chemistry - Alcohol, Phenols and Ethers Question 11 English Explanation

Q.43

Complete the following reaction:

NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 18 English

[C] is _______.

(A)
NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 18 English Option 1
(B)
NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 18 English Option 2
(C)
NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 18 English Option 3
(D)
NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 18 English Option 4
(C)

Solution

NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 18 English Explanation
Q.44

Identify the major product obtained in the following reaction:

NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 20 English

(A)
NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 20 English Option 1
(B)
NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 20 English Option 2
(C)
NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 20 English Option 3
(D)
NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 20 English Option 4
(B)

Solution

NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 20 English Explanation
Q.45

Identify the final product [D] obtained in the following sequence of reactions.

NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 19 English

(A)
NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 19 English Option 1
(B)
CH
(C)
(D)
NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 19 English Option 4
(D)

Solution

NEET 2023 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 19 English Explanation
Q.46

Identify the product in the following reaction:

NEET 2023 Chemistry - Organic Compounds Containing Nitrogen Question 13 English

(A)
NEET 2023 Chemistry - Organic Compounds Containing Nitrogen Question 13 English Option 1
(B)
NEET 2023 Chemistry - Organic Compounds Containing Nitrogen Question 13 English Option 2
(C)
NEET 2023 Chemistry - Organic Compounds Containing Nitrogen Question 13 English Option 3
(D)
NEET 2023 Chemistry - Organic Compounds Containing Nitrogen Question 13 English Option 4
(A)

Solution

NEET 2023 Chemistry - Organic Compounds Containing Nitrogen Question 13 English Explanation
Q.47

Which of the following reactions will NOT give primary amine as the product?

(A)
Product
(B)
Product
(C)
Product
(D)
Product
(B)

Solution

NEET 2023 Chemistry - Organic Compounds Containing Nitrogen Question 14 English Explanation 1NEET 2023 Chemistry - Organic Compounds Containing Nitrogen Question 14 English Explanation 2
Q.48

Which amongst the following molecules on polymerization produces neoprene?

(A)
NEET 2023 Chemistry - Polymers Question 2 English Option 1
(B)
HC = CH C CH
(C)
NEET 2023 Chemistry - Polymers Question 2 English Option 3
(D)
HC = CH CH = CH
(A)

Solution

NEET 2023 Chemistry - Polymers Question 2 English Explanation
Q.49

Given below are two statements:

Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside

Statement II : When nucleoside is linked to phosphorous acid at 5' position of sugar moiety, we get nucleotide.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are false
(B)
Statement I is true but Statement II is false
(C)
Statement I is false but Statement II is true
(D)
Both Statement I and Statement II are true
(B)

Solution

NEET 2023 Chemistry - Biomolecules Question 10 English Explanation 1

Base link with 1' position of sugar in nucleoside so statement I is correct.

NEET 2023 Chemistry - Biomolecules Question 10 English Explanation 2

When nucleoside is linked to phosphoric acid at 5' position of sugar moiety we get a nucleotide

Statement II is incorrect because not link with phosphorous acid.

Q.50

Some tranquilizers are listed below. Which one from the following belongs to barbiturates?

(A)
Meprobamate
(B)
Valium
(C)
Veronal
(D)
Chlordiazepoxide
(C)

Solution

Veronal is an example of barbiturates.

Biology (Maximum Marks: 400)
  • This section contains 100 questions.
  • Each question has FOUR options (A), (B), (C) and (D). ONLY ONE of these four options is the correct answer.
  • Full Marks : +4 If ONLY the correct option is chosen;
  • Zero Marks : 0 If none of the options is chosen (i.e. the question is unanswered);
  • Negative Marks : −1 In all other cases.
Q.1

In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as

(A)
Dedifferentiation
(B)
Development
(C)
Senescence
(D)
Differentiation
(A)

Solution

In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as dedifferentiation.

Dedifferentiation is a phenomenon by which the living differentiated plant cells, that by now have lost the capacity to divide can regain the capacity of division under certain conditions.

Q.2

How many different proteins does the ribosome consist of?

(A)
60
(B)
40
(C)
20
(D)
80
(D)

Solution

The ribosome consists of structural RNAs and about 80 different proteins.

Q.3

Which of the following are NOT considered as the part of endomembrane system?

A. Mitochondria

B. Endoplasmic reticulum

C. Chloroplasts

D. Golgi complex

E. Peroxisomes

Choose the most appropriate answer from the options given below:

(A)
A, C and E only
(B)
A and D only
(C)
A, D and E only
(D)
B and D only
(A)

Solution

The endomembrane system in a cell includes:

- The nuclear envelope

- The endoplasmic reticulum (ER)

- The Golgi apparatus (Golgi complex)

- Lysosomes

- Vesicles

- The plasma membrane

This system is involved in the modification, packaging, and transport of proteins and lipids.

Mitochondria and chloroplasts are not part of the endomembrane system. They are both organelles with their own separate membranes, and they have their own DNA. They are thought to have originated from a symbiotic relationship with prokaryotic cells, a theory known as endosymbiosis.

Peroxisomes, although they are membrane-bound organelles involved in many metabolic reactions, are also not considered part of the endomembrane system because they do not communicate with the other endomembrane organelles and are not involved in protein sorting or lipid synthesis like the other components of the endomembrane system.

Therefore, the answer is :

Option A : A, C, and E only.
Q.4

Which of the following functions is carried out by cytoskeleton in a cell?

(A)
Protein synthesis
(B)
Motility
(C)
Transportation
(D)
Nuclear division
(B)

Solution

An elaborate network of filamentous proteinaceous structures consisting of microtubules, microfilaments and intermediate filaments present in cytoplasm is collectively referred to as the cytoskeleton. It is involved in many functions such as mechanical support, motility, maintenance of the shape of the cell.

Q.5

Cellulose does not form blue colour with Iodine because

(A)
It is a helical molecule
(B)
It does not contain complex helices and hence cannot hold iodine molecules
(C)
It breaks down when iodine reacts with it
(D)
It is a disaccharide
(B)

Solution

Option (B) is the correct answer because cellulose does not contain complex helices and hence cannot hold iodine molecules.

Option (A), (C) and (D) are not correct as cellulose is a polysaccharide.

Q.6

Given below are two statements:

Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal).

Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of type and two subunits of type.)

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are false.
(B)
Statement I is true but Statement II is false.
(C)
Statement I is false but Statement II is true.
(D)
Both Statement I and Statement II are true.
(C)

Solution

The correct answer is option (C) as a protein is imagined as a line, the left end represented by the first amino acid and the right end is represented by the last amino acid. The first amino acid is also called N-terminal amino acid. The last amino acid is called the C-terminal amino acid.

Q.7

Given below are two statements :

Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.

Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are false.
(B)
Statement I is true but Statement II is false.
(C)
Statement I is false but Statement II is true.
(D)
Both Statement I and Statement II are true.
(D)

Solution

Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.

  • This statement is true. Low temperatures can slow down enzyme activity but do not typically denature the enzyme, essentially preserving it in an inactive state. High temperatures, on the other hand, can cause the enzyme (which is a protein) to denature, or lose its structure, which leads to a loss of enzymatic activity.

Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as a competitive inhibitor.

  • This statement is also true. A competitive inhibitor is a substance that binds to the active site of an enzyme, preventing the substrate from binding and thus inhibiting the enzyme's activity. Because it competes with the substrate for the same active site, a competitive inhibitor often has a structure that closely resembles that of the substrate.

So, the correct answer is :

Option D : Both Statement I and Statement II are true.

Q.8

The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?

(A)
Pachytene
(B)
Diplotene
(C)
Diakinesis
(D)
Zygotene
(A)

Solution

Recombination nodules appear during the pachytene stage of prophase I in meiosis. These nodules are thought to be involved in crossing over, a process where homologous chromosomes exchange genetic material. This leads to genetic recombination, which is a significant source of genetic variation in sexually reproducing organisms.

So, the correct answer is :

Option A : Pachytene.
Q.9

Which of the following stages of meiosis involves division of centromere?

(A)
Metaphase II
(B)
Anaphase II
(C)
Telophase
(D)
Metaphase I
(B)

Solution

The correct answer is Option B : Anaphase II.

During meiosis, the division of the centromere occurs in Anaphase II. At this stage, the sister chromatids of each chromosome (which are attached at the centromere) are pulled apart and move toward opposite poles of the cell. This is similar to what happens in anaphase of mitosis. In contrast, during Anaphase I of meiosis, homologous chromosomes are separated but the centromeres do not divide, meaning the sister chromatids stay together.

Q.10

Among eukaryotes, replication of DNA takes place in :

(A)
S phase
(B)
G1 phase
(C)
G2 phase
(D)
M phase
(A)

Solution

In eukaryotes, DNA replication takes place during the S phase (Synthesis phase) of the cell cycle. During this phase, the entire genome is replicated, resulting in two copies of each chromosome to ensure that both daughter cells receive a complete set of genetic information during cell division.
Q.11

Match List I with List II:

List I List II
(A) M Phase (I) Proteins are synthesized
(B) G Phase (II) Inactive phase
(C) Quiescent stage (III) Interval between mitosis and initiation of DNA replication
(D) G Phase (IV) Equational division

Choose the correct answer from the options given below :

(A)
A-IV, B-II, C-I, D-III
(B)
A-IV, B-I, C-II, D-III
(C)
A-II, B-IV, C-I, D-III
(D)
A-III, B-II, C-IV, D-I
(B)

Solution

M phase or mitosis is the phase where the actual cell division occurs. Mitosis is also called equational division.

During G2 phase DNA synthesis stops but cell synthesis RNA, proteins, etc. for next phase.

Quiescent stage is inactive phase in which non-dividing cells enters.

G1 phase is the interval between mitosis and initiation of DNA replication.

Therefore, option (B) is correct.

Q.12

Select the correct statements.

A. Tetrad formation is seen during Leptotene.

B. During Anaphase, the centromeres split and chromatids separate.

C. Terminalization takes place during Pachytene.

D. Nucleolus, Golgi complex and ER are reformed during Telophase.

E. Crossing over takes place between sister chromatids of homologous chromosome.

Choose the correct answer from the options given below:

(A)
B and D only
(B)
A, C and E only
(C)
B and E only
(D)
A and C only
(A)

Solution

1. Tetrad formation is seen during the Zygotene stage : During the Zygotene stage of Prophase I in meiosis, homologous chromosomes pair up, forming tetrads or bivalents.

2. During Anaphase, the centromeres split and chromatids separate : In Anaphase, the centromeres divide, and the sister chromatids are pulled apart towards opposite poles of the cell.

3. Terminalization of chiasmata takes place during Diakinesis : Diakinesis is the final stage of Prophase I in meiosis. During this stage, terminalization occurs, which is the process in which chiasmata, the points of crossing over between non-sister chromatids, move toward the ends of the chromosomes.

4. Nucleolus, Golgi complex, and ER are reformed during Telophase : During Telophase, the nuclear envelope starts to reassemble around the separated chromosomes, and the nucleolus, Golgi complex, and endoplasmic reticulum (ER) are reformed.

5. Crossing over takes place between non-sister chromatids of homologous chromosomes : This process occurs during the Pachytene stage of Prophase I in meiosis, leading to the exchange of genetic material between the non-sister chromatids, which increases genetic diversity in the resulting gametes.
Q.13

Given below are two statements:

Statement I : During G0 phase of cell cycle, the cell is metabolically inactive.

Statement II : The centrosome undergoes duplication during S phase of interphase.

In the light of the above statements, choose the most appropriate answer from the options given below:

(A)
Both Statement I and Statement II are incorrect.
(B)
Statement I is correct but Statement II is incorrect.
(C)
Statement I is incorrect but Statement II is correct.
(D)
Both Statement I and Statement II are correct.
(C)

Solution

Statement I is incorrect. The G0 phase is a state in the cell cycle in which cells exist in a quiescent or dormant stage. However, this does not mean that the cell is metabolically inactive. Rather, the cell maintains its normal functions but is not preparing for cell division.

Statement II is correct. During the S phase (synthesis phase) of interphase, DNA replication occurs, and the centrosome, which plays a key role in cell division, also duplicates. This prepares the cell for the later stages of the cell cycle, where the cell divides into two daughter cells.
Q.14

What is the function of tassels in the corn cob?

(A)
To trap pollen grains
(B)
To disperse pollen grains
(C)
To protect seeds
(D)
To attract insects
(A)

Solution

Tassels in the com cob represents stigma and style which wave in the wind to trap pollen grains.

Q.15

Large, colourful, fragrant flowers with nectar are seen in

(A)
Bird pollinated plants
(B)
Bat pollinated plants
(C)
Wind pollinated plants
(D)
Insect pollinated plants
(D)

Solution

Large, colorful, fragrant flowers with nectar are features that attract biotic pollinators. Insect pollinated plants, also known as entomophilous plants, often have these characteristics to attract insects such as bees, butterflies, and moths, which play a significant role in their pollination process.
Q.16

In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :

(A)
Antipodals, synergids, and primary endosperm nucleus
(B)
Synergids, Zygote and Primary endosperm nucleus
(C)
Synergids, antipodals and Polar nuclei
(D)
Synergids, Primary endosperm nucleus and zygote
(B)

Solution

Synergids are the cells of gametophyte and hence these are haploid Zygote is formed by fusion of two gametes and thus it is diploid.

Primary endosperm nucleus is formed by the fusion of diploid secondary nucleus with a male gamete. Therefore, it is triploid.

Q.17

Given below are two statements : One labelled as Assertion A and the other labelled as Reason R :

Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.

Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.

In the light of the above statements, choose the correct answer from the options given below :

(A)
Both A and R are true but R is NOT the current explanation of A
(B)
A is true but R is false
(C)
A is false but R is true
(D)
Both A and R are true and R is the correct explanation of A
(B)

Solution

The correct answer is Option B : A is true but R is false.

Assertion A is true. In gymnosperms, the pollen grains are indeed released from the microsporangium and are typically carried by air currents, a method of pollination known as anemophily.

Reason R is false. Although it's true that air currents carry the pollen grains, the pollen grains do not directly reach the mouth of the archegonia in gymnosperms. Instead, they land on the ovule, where they germinate and form a pollen tube that delivers the male gametes to the egg. Therefore, a pollen tube is formed in gymnosperms, contrary to what Reason R suggests.

Q.18

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :

Assertion A : Late wood has fewer xylary elements with narrow vessels.

Reason R : Cambium is less active in winters.

In the light of the above statements, choose the correct answer from the options given below :

(A)
Both A and R are true but R is NOT the correct explanation of A
(B)
A is true but R is false
(C)
A is false but R is true
(D)
Both A and R are true and R is the correct explanation of A
(D)

Solution

Late wood, formed in the latter part of the growing season, indeed has fewer xylary elements with narrower vessels. This is because the cambium, the layer of cells in plants that gives rise to secondary xylem (wood), is less active in colder temperatures, which are typically associated with the later parts of the growing season, such as autumn and winter.

So, both Assertion A and Reason R are true. Moreover, Reason R correctly explains why Assertion A is the case: the decreased activity of the cambium in colder temperatures results in the formation of late wood with fewer, narrower vessels.

Therefore, the correct answer is :

Option D : Both A and R are true and R is the correct explanation of A.

Q.19

Given below are two statements :

Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.

Statement II : Exarch condition is the most common feature of the root system.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are false
(B)
Statement I is correct but Statement II is false
(C)
Statement I is incorrect but Statement II is true
(D)
Both Statement I and Statement II are true
(C)

Solution

Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.

  • This statement is incorrect. Endarch and exarch are used to describe the developmental sequence of primary xylem, not secondary xylem. In endarch condition, the first formed xylem is towards the centre (protoxylem) and the last formed xylem is towards the periphery (metaxylem), which is typical of stems. In the exarch condition, the first formed xylem is towards the periphery and the last formed xylem is towards the centre, which is typical of roots.

Statement II : Exarch condition is the most common feature of the root system.

  • This statement is true. The exarch condition, where the first-formed xylem is towards the periphery and the last-formed xylem is towards the centre, is indeed the most common feature of the root system.

So, the correct answer is :

Option C : Statement I is incorrect but Statement II is true.

Q.20

Movement and accumulation of ions across a membrane against their concentration gradient can be explained by

(A)
Facilitated Diffusion
(B)
Passive Transport
(C)
Active Transport
(D)
Osmosis
(C)

Solution

Movement and accumulation of ions across a membrane against their concentration gradient can be explained by active transport. It uses energy to transport molecules from lower concentration to a higher concentration.

Q.21

Given below are two statements :

Statement I : The forces generated transpiration can lift a xylem-sized column of water over 130 meters height.

Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees evaporative cooling.

In the light of the above statements, choose the most appropriate answer from the options given below :

(A)
Both Statement I and Statement II are incorrect
(B)
Statement I is correct but Statement II is incorrect
(C)
Statement I is incorrect but Statement II is correct
(D)
Both Statement I and Statement II are correct
(D)

Solution

Statement I is correct as measurements reveal that the forces generated by transpiration can create pressures sufficient to lift a xylem sized column of water up to 130 meters high.

Statement II is also correct. Transpiration has a cooling effect on plant tissues. As water evaporates from the surfaces of leaves, it removes heat, reducing the temperature. This process, known as evaporative cooling, can lower the temperature of the leaf surface by 10 to 15 degrees.

Q.22

Identify the correct statements:

A. Lenticels are the lens-shaped openings permitting the exchange of gases.

B. Bark formed early in the season is called hard bark.

C. Bark is a technical term that refers to all tissues exterior to vascular cambium.

D. Bark refers to periderm and secondary phloem.

E. Phellogen is single-layered in thickness.

Choose the correct answer from the options given below:

(A)
A and D only
(B)
A, B and D only
(C)
B and C only
(D)
B, C and E only
(A)

Solution

Lenticels are lens shaped opening permitting exchange of gases between the outer atmosphere and internal tissue of the stem.

Bark that is formed early in the season is called early or soft bark. Towards the end of the season late or hard bark is formed.

Bark is non-technical term that refer to all tissues exterior to vascular cambium.

Bark refers to a number of tissue types, viz periderm and secondary phloem.

Phellogen is couple of layers thick

Therefore, only statement A and D are correct.

Q.23

Match List I with List II :

List I List II
(A) Cohesion (I) More attraction in liquid phase
(B) Adhesion (II) Mutual attraction among water molecules
(C) Surface tension (III) Water loss in liquid phase
(D) Guttation (IV) Attraction towards polar surfaces

Choose the correct answer from the options given below :

(A)
A – IV, B – III, C – II, D – I
(B)
A – III, B – I, C – IV, D – II
(C)
A – II, B – I, C – IV, D – III
(D)
A – II, B – IV, C – I, D – III
(D)

Solution

The correct answer is :

Option D : A – II, B – IV, C – I, D – III

Explanation :

(A) Cohesion - (II) Mutual attraction among water molecules. Cohesion is the property that makes water molecules attracted to each other, causing them to stick together.

(B) Adhesion - (IV) Attraction towards polar surfaces. Adhesion is the property of different substances to bond with each other. In the context of water, it refers to water's ability to "stick" to polar surfaces.

(C) Surface tension - (I) More attraction in liquid phase. Surface tension is the property that allows the surface of a liquid to resist external force, due to the cohesive nature of its molecules. It's why small insects can walk on water without breaking the surface.

(D) Guttation - (III) Water loss in liquid phase. Guttation is the process in plants where water is lost from the edges of the leaves in the form of liquid droplets, typically when soil moisture levels are high.

Q.24

Which micronutrient is required for splitting of water molecule during photosynthesis?

(A)
Molybdenum
(B)
Magnesium
(C)
Copper
(D)
Manganese
(D)

Solution

Manganese plays a major role in the splitting of water to liberate oxygen during photosynthesis.

Copper is essential for the overall metabolism in plants.

Molybdenum is included in nitrogen metabolism.

Magnesium activates several enzymes involved in photosynthesis and respiration.

Q.25

Match List I with List II:

List I List II
(A) Iron (I) Synthesis of auxin
(B) Zinc (II) Component of nitrate reductase
(C) Boron (III) Activator of catalase
(D) Molybdenum (IV) Cell elongation and differentiation

Choose the correct answer from the options given below:

(A)
A-II, B-III, C-IV, D-I
(B)
A-III, B-I, C-IV, D-II
(C)
A-II, B-IV, C-I, D-III
(D)
A-III, B-II, C-I, D-IV
(B)

Solution

A) Iron : It is involved in the synthesis of chlorophyll and is an activator of catalase.

B) Zinc : It is required for the synthesis of the plant growth hormone auxin.

C) Boron : It is essential for cell elongation and differentiation, as well as pollen germination.

D) Molybdenum : It is a component of nitrate reductase, an enzyme that reduces nitrate to nitrite in plants.

So, the correct matching is :

A-III, B-I, C-IV, D-II
Q.26

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :

Assertion A : ATP is used at two steps in glycolysis.

Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1, 6-diphosphate.

In the light of the above statements, choose the correct answer from the options given below :

(A)
Both A and R are true but R is NOT the correct explanation of A.
(B)
A is true but R is false.
(C)
A is false but R is true.
(D)
Both A and R are true and R is the correct explanation of A.
(D)

Solution

The process of glycolysis involves the breakdown of glucose into two molecules of pyruvate. This metabolic pathway is divided into two parts: the energy investment phase and the energy payoff phase.

In the energy investment phase, two molecules of ATP are indeed used. The first ATP is used to convert glucose into glucose-6-phosphate, and the second ATP is used to convert fructose-6-phosphate into fructose-1, 6-diphosphate. These steps are necessary to prepare the glucose molecule for the energy payoff phase, where ATP will be generated.

So, both Assertion A and Reason R are true, and Reason R correctly explains Assertion A.

Therefore, the answer is :

Option D : Both A and R are true and R is the correct explanation of A.
Q.27

Which of the following combinations is required for chemiosmosis?

(A)
Membrane, proton pump, proton gradient, NADP synthase
(B)
Proton pump, electron gradient, ATP synthase
(C)
Proton pump, electron gradient, NADP synthase
(D)
Membrane, proton pump, proton gradient, ATP synthase
(D)

Solution

Chemiosmosis is a process by which ATP (adenosine triphosphate) is produced in the cell. It relies on a concentration gradient of protons (H+ ions) across a membrane. The proton gradient is created by a proton pump. As protons flow back across the membrane, down their concentration gradient, they pass through a protein complex called ATP synthase, which uses the energy of the proton flow to produce ATP.

So, the correct answer is :

Option D : Membrane, proton pump, proton gradient, ATP synthase

Q.28

Match List I with List II:

List I List II
(A) Oxidative decarboxylation (I) Citrate synthase
(B) Glycolysis (II) Pyruvate dehydrogenase
(C) Oxidative phosphorylation (III) Electron transport system
(D) Tricarboxylic acid cycle (IV) EMP pathway

Choose the correct answer from the options given below :

(A)
A – II, B – IV, C – I, D – III
(B)
A – III, B – I, C – II, D – IV
(C)
A – II, B – IV, C – III, D – I
(D)
A – III, B – IV, C – II, D – I
(C)

Solution

Pyruvate, which is formed by the glycolytic catabolism of carbohydrates in the cytosol, after it enters mitochondrial matrix undergoes oxidative decarboxylation by a complex set of reactions catalyzed by pyruvate dehydrogenase.

The scheme of glycolysis was given by Gustav Embden, Otto Meyrhof and J. Parnas, and is often referred to as the EMP pathway.

In electron transport system, the energy of oxidation-reduction is utilized for the production of proton gradient required for phosphorylation, thus, this process is also called oxidative phosphorylation.

The TCA (tricarboxylic acid cycle) starts with the condensation of acetyl group with oxaloacetic acid (OAA) and water to yield citric acid. The reaction is catalysed by the enzyme citrate synthase. Thus, option (C) is correct.

Q.29

Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of

(A)
Amylase
(B)
Lipase
(C)
Dinitrogenase
(D)
Succinic dehydrogenase
(D)

Solution

Melonate is a known inhibitor of the enzyme succinic dehydrogenase, which is involved in the citric acid cycle (also known as the Krebs cycle or TCA cycle), an essential metabolic pathway in many organisms, including bacteria.

By inhibiting succinic dehydrogenase, melonate can disrupt the normal metabolism of pathogenic bacteria and inhibit their growth.

So, the correct answer is :

Option D : Succinic dehydrogenase

Q.30

Which of the following is not a cloning vector?

(A)
YAC
(B)
pBR322
(C)
Probe
(D)
BAC
(C)

Solution

Option (C) is correct answer because a single stranded DNA or RNA tagged with a radioactive molecule is called a probe and it helps in the detection of mutated gene.

Option (A), (B) and (D) are not correct because YAC, BAC, pBR322 are vectors.

Q.31

Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?

(A)
Over exploitation for economic gain
(B)
Alien species invasions
(C)
Co-extinctions
(D)
Habitat loss and fragmentation
(D)

Solution

Option D : Habitat loss and fragmentation is considered the most important cause driving extinction of species among 'The Evil Quartet'.

The 'Evil Quartet' refers to the four major causes of biodiversity loss: habitat destruction and fragmentation, over-exploitation, pollution, and invasive species. Of these, habitat loss and fragmentation is generally considered the most significant cause, as it directly affects the availability of the resources and space that organisms need to survive. It can be caused by a variety of human activities, including deforestation, urbanization, and agriculture. This loss of habitat leads to smaller, more isolated populations, which are more vulnerable to other threats and have a higher risk of extinction.

Q.32

The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year

(A)
1992
(B)
1986
(C)
2002
(D)
1985
(A)

Solution

The Earth Summit, formally known as the United Nations Conference on Environment and Development (UNCED), was indeed held in Rio de Janeiro, Brazil, in 1992. This meeting marked a significant step forward in global conservation efforts, leading to the establishment of the Convention on Biological Diversity, among other important agreements.
Q.33

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.

(A)
Polyadelphous and epipetalous stamens
(B)
Monoadelphous and Monothecous anthers
(C)
Epiphyllous and Dithecous anthers
(D)
Diadelphous and Dithecous anthers
(D)

Solution

Fabaceae Diadelphous and dithecous anther.

Solanaceae Polyandrous, epipetalous and dithecous anther.

Liliaceae Polyandrous, epiphyllous and dithecous anther.

Q.34

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :

Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem.

Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive node instead of leaves.

In the light of the above statements, choose the correct answer from the options given below :

(A)
Both A and R are true but R is NOT the correct explanation of A
(B)
A is true but R is false
(C)
A is false but R is true
(D)
Both A and R are true and R is the correct explanation of A
(D)

Solution

The correct answer is :

Option D : Both A and R are true and R is the correct explanation of A

Explanation :

Statement A is true. A flower is indeed a modified shoot wherein the shoot apical meristem changes to a floral meristem.

Statement R is also true. In the process of flower formation, the internodes of the shoot get condensed, and instead of leaves, different floral appendages (such as sepals, petals, stamens, and carpels) are produced laterally at successive nodes.

Moreover, Statement R is indeed the correct explanation for Statement A. The transition from the shoot apical meristem to the floral meristem involves the condensation of internodes and the lateral production of floral appendages at nodes, which leads to the formation of a flower.

Q.35

How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during Calvin cycle?

(A)
18 ATP and 12 NADPH2
(B)
12 ATP and 16 NADPH2
(C)
18 ATP and 16 NADPH2
(D)
12 ATP and 12 NADPH2
(A)

Solution

For every CO2 molecule entering the Calvin cycle, 3 molecules of ATP and 2 of NADPH2 are required. To make one molecule of glucose, 6 turns of the cycle are required. Thus, ATP and NADPH2 molecules required for synthesis of one molecule of glucose during Calvin cycle will be

NEET 2023 Biology - Photosynthesis in Higher Plants Question 21 English Explanation

Q.36

The reaction centre in PS II has an absorption maxima at

(A)
700 nm
(B)
660 nm
(C)
780 nm
(D)
680 nm
(D)

Solution

In PS-I, the reaction centre chlorophyll a has an absorption peak at 700 nm, while in PS-II, reaction centre has an absorption maxima at 680 nm.

Q.37

Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

(A)
Sutton and Boveri
(B)
Alfred Sturtevant
(C)
Henking
(D)
Thomas Hunt Morgan
(B)

Solution

Alfred Sturtevant used the frequency of recombination between gene pairs on the same chromosome as a measure of the distance between genes and ‘mapped’ their position on the chromosome.

Sutton and Boveri proposed chromosomal theory of inheritance.

Henking discovered X-chromosome.

Thomas Hunt Morgan proved chromosomal theory of inheritance and proposed the concept of linkage.

Q.38

The phenomenon of pleiotropism refers to

(A)
Presence of two alleles, each of the two genes controlling a single trait
(B)
A single gene affecting multiple phenotypic expression
(C)
More than two genes affecting a single character
(D)
Presence of several alleles of a single gene controlling a single crossover
(B)

Solution

When a single gene affects multiple phenotypic expression, the gene is called pleiotropic gene and the phenomenon is called pleiotropism.

Q.39

Which of the following statements are correct about Klinefelter’s Syndrome?

A. This disorder was first described by Langdon Down (1866).

B. Such an individual has overall masculine development. However, the feminine development is also expressed.

C. The affected individual is short statured.

D. Physical, psychomotor and mental development is retarded.

E. Such individuals are sterile.

Choose the correct answer from the options given below :

(A)
C and D only
(B)
B and E only
(C)
A and E only
(D)
A and B only
(B)

Solution

Option B :

B and E only

Explanation :

B. Such an individual has overall masculine development. However, the feminine development is also expressed. People with Klinefelter syndrome are male (XY), but they often have certain physical characteristics that may be typically associated with female development, such as wider hips, less body hair, and sometimes breast tissue development.

E. Such individuals are sterile. Often, individuals with Klinefelter syndrome produce little to no sperm and are therefore usually infertile. However, there are cases where fertility treatments can help some men with Klinefelter syndrome to father children.

For the other options :

A. This disorder was first described by Langdon Down (1866). This is incorrect. Klinefelter's syndrome was first described by Dr. Harry Klinefelter in the 1940s, not by Langdon Down.

C. The affected individual is short statured. This is incorrect. In fact, individuals with Klinefelter's syndrome are often taller than average.

D. Physical, psychomotor and mental development is retarded. This is also incorrect. While individuals with Klinefelter syndrome may have some learning difficulties or delays, particularly with language and speech, it is not accurate or appropriate to say that their physical, psychomotor, and mental development is "retarded". They may face some challenges, but with support they can lead healthy, productive lives.

Q.40

Broad palm with single palm crease is visible in a person suffering from-

(A)
Turner’s syndrome
(B)
Klinefelter’s syndrome
(C)
Thalassemia
(D)
Down’s syndrome
(D)

Solution

A broad palm with a single palmar crease, also known as a "simian crease," is often associated with Down's Syndrome. Down's Syndrome is a genetic disorder caused by the presence of all or part of a third copy of chromosome 21. It is characterized by certain physical features, including a flat facial profile, an upward slant to the eyes, and a single palmar crease.

So, the correct answer is :

Option D : Down's syndrome.
Q.41

Which one of the following symbols represents mating between relatives in human pedigree analysis?

(A)
NEET 2023 Biology - Principles of Inheritance and Variation Question 30 English Option 1
(B)
NEET 2023 Biology - Principles of Inheritance and Variation Question 30 English Option 2
(C)
NEET 2023 Biology - Principles of Inheritance and Variation Question 30 English Option 3
(D)
NEET 2023 Biology - Principles of Inheritance and Variation Question 30 English Option 4
(A)

Solution

The symbol representing mating between relatives (consanguineous mating) in human pedigree analysis is

NEET 2023 Biology - Principles of Inheritance and Variation Question 30 English Explanation

Q.42

Unequivocal proof that DNA is the genetic material was first proposed by

(A)
Alfred Hershey and Martha Chase
(B)
Avery, Macleoid and McCarthy
(C)
Wilkins and Franklin
(D)
Frederick Griffith
(A)

Solution

The first unequivocal proof that DNA is the genetic material came from the experiments conducted by Alfred Hershey and Martha Chase in 1952. They used bacteriophages (viruses that infect bacteria) and radioactively labeled the protein and DNA of the phage separately in two different sets of experiments. They found that it was the DNA, not the protein, of the phage that was injected into the bacteria and carried the genetic information necessary for the production of new phage particles.

Avery, Macleoid and McCarty gave the biochemical characterisation of Transforming Principle.

The transformation experiments by using Pneumococcus was conducted by Frederick Griffith.

Wilkins and Franklin produced X-ray diffraction data of DNA.

So, the correct answer is :

Option A : Alfred Hershey and Martha Chase.

Q.43

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

(A)
Transcription of tRNA, 5S rRNA and snRNA
(B)
Transcription of precursor of mRNA
(C)
Transcription of only snRNAs
(D)
Transcription of rRNAs (28S, 18S and 5.8S)
(A)

Solution

In eukaryotes there are three major types of RNA polymerases.

RNA polymerase I transcribes : 5.8S, 18S, 28S rRNAs

RNA polymerase II transcribes : hnRNAs (precurssor of mRNA)

RNA polymerase III transcribes : tRNAs, ScRNA, 5S rRNA and snRNA

Q.44

Expressed Sequence Tags (ESTs) refers to

(A)
All genes that are expressed as proteins.
(B)
All genes whether expressed or unexpressed.
(C)
Certain important expressed genes.
(D)
All genes that are expressed as RNA.
(D)

Solution

Expressed Sequence Tags (ESTs) are short sub-sequences of a cDNA sequence. They may identify expressed genes, so they are derived from mRNA which is transcribed from expressed genes. They serve as a kind of "tag" or marker for identifying the gene from which it was transcribed. Therefore, ESTs represent genes that are expressed as RNA. The other options listed do not accurately describe what ESTs are.
Q.45

Upon exposure to UV radiation, DNA stained with ethidium bromide will show

(A)
Bright blue colour
(B)
Bright yellow colour
(C)
Bright orange colour
(D)
Bright red colour
(C)

Solution

Option (C) is the correct answer because in recombinant DNA technology the separated DNA fragments can be visualised only after staining the DNA with a substance known as ethidium bromide followed by exposure to U.V. radiation. You can see bright orange coloured bands of DNA in an ethidium bromide stained gel exposed to U.V. light.

Q.46

Match List I with List II.

List I List II
(A) Gene 'a' (I) -galactosidase
(B) Gene 'y' (II) Transacetylase
(C) Gene 'i' (III) Permease
(D) Gene 'z' (IV) Repressor protein

Choose the correct answer from the options given below :

(A)
A-II, B-III, C-IV, D-I
(B)
A-III, B-IV, C-I, D-II
(C)
A-III, B-I, C-IV, D-II
(D)
A-II, B-I, C-IV, D-III
(A)

Solution

The question relates to the lac operon model in E. coli, which is a well-studied example of gene regulation. In this model :

- Gene 'z' codes for beta-galactosidase (breaks down lactose into glucose and galactose)

- Gene 'y' codes for permease (transports lactose into the cell)

- Gene 'a' codes for transacetylase (may help in lactose metabolism, but its exact role is unclear)

- Gene 'i' codes for the repressor protein (binds to the operator to prevent transcription)

So, matching the List I (genes) with List II (proteins they code for) :

- A (Gene 'a') matches with II (Transacetylase)

- B (Gene 'y') matches with III (Permease)

- C (Gene 'i') matches with IV (Repressor protein)

- D (Gene 'z') matches with I (Beta-galactosidase)

Therefore, the correct option is :

Option A : A-II, B-III, C-IV, D-I
Q.47

Given below are two statements:

Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.

Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are false.
(B)
Statement I is correct but Statement II is false.
(C)
Statement I is incorrect but Statement II is true.
(D)
Both Statement I and Statement II are true.
(C)

Solution

In prokaryotes, the negatively charged DNA is held with some positively charged proteins in a region termed as nucleoid.

In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form a structure called nucleosome.

Q.48

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

(A)
3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
(B)
5’ ATCGATCGATCGATCGATCGATCGATCG 3’
(C)
3’ ATCGATCGATCGATCGATCGATCGATCG 5’
(D)
5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
(B)

Solution

The sequence on the mRNA is 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’. The mRNA is synthesized from the template strand of DNA by complementary base pairing, following these rules: A pairs with U, U pairs with A, C pairs with G, and G pairs with C. The coding strand of DNA has the same sequence as the mRNA, except with T instead of U.

To find the sequence on the corresponding coding strand, we can use these rules to convert the mRNA sequence back to DNA :

5’ AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’ (mRNA)

5’ ATCGATCGATCGATCGATCGATCG ATCG 3’ (coding strand DNA)

NEET 2023 Biology - Molecular Basis of Inheritance Question 42 English Explanation

Q.49

Which one of the following is NOT an advantage of inbreeding?

(A)
It exposes harmful recessive genes but are eliminated by selection.
(B)
Elimination of less desirable genes and accumulation of superior genes takes place due to it.
(C)
It decreases the productivity of inbred population, after continuous inbreeding.
(D)
It decreases homozygosity.
(C)

Solution

Inbreeding, the mating of closely related individuals, can indeed lead to decreased productivity and viability in a population over time, a phenomenon known as inbreeding depression. This is generally considered a disadvantage of inbreeding. The other options listed are typically seen as potential advantages of inbreeding in controlled environments (like selective breeding in agriculture or animal husbandry), although they also come with significant risks.
Q.50

During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out

(A)
DNA
(B)
Histones
(C)
Polysaccharides
(D)
RNA
(A)

Solution

Option (A) is the correct answer as, during isolation of the genetic material, purified DNA ultimately precipitates out after the addition of chilled ethanol.

Option (B) is not the answer as, proteins can be removed by treatment with proteases.

Option (D) is not the answer as RNA can be removed by treatment with ribonuclease.

Q.51

In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.

(A)
Zinc
(B)
Tungsten or gold
(C)
Silver
(D)
Copper
(B)

Solution

Option (B) is the correct answer because in gene gun method, microparticles of tungsten or gold are used. Gold or tungsten are inert in nature so they do not alter the chemical composition of cells.

Q.52

Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.

A. Insertion of recombinant DNA into the host cell

B. Cutting of DNA at specific location by restriction enzyme

C. Isolation of desired DNA fragment

D. Amplification of gene of interest using PCR

Choose the correct answer from the options given below :

(A)
C, A, B, D
(B)
C, B, D, A
(C)
B, D, A, C
(D)
B, C, D, A
(D)

Solution

The correct answer is option (D) because recombinant DNA technology involves several steps in specific sequence such as isolation of DNA, fragmentation of DNA by restriction endonucleases, isolation of desired DNA fragment, ligation of the DNA fragment into a vector, transferring the recombinant DNA into the host, culturing the host cells in a medium at large scale and extraction of the desired product.

Q.53

Given below are two statements:

Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.

Statement II : In general, carnivores are more adversely affected by competition than herbivores.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are false.
(B)
Statement I is correct Statement II is false.
(C)
Statement I is incorrect but Statement II is true.
(D)
Both Statement I and Statement II are true.
(B)

Solution

Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and the competitively inferior one will be eliminated eventually. Thus, statement I is correct.

Statement II is incorrect as in general, herbivores and plants appear to be more adversely affected by competition than carnivores.

Q.54

Match List I with List II.

List I
(Interacting species)
List II
(Name of interaction)
(A) A Leopard and a Lion in a forest/grassland (I) Competition
(B) A Cuckoo laying egg in a Crow's nest (II) Brood parasitism
(C) Fungi and root of a higher plant in Mycorrhizae (III) Mutualism
(D) A cattle egret and a Cattle in a field (IV) Commensalism

Choose the correct answer from the options given below.

(A)
A-I, B-II, C-IV, D-III
(B)
A-III, B-IV, C-I, D-II
(C)
A-II, B-III, C-I, D-IV
(D)
A-I, B-II, C-III, D-IV
(D)

Solution

- A leopard and a lion in a forest/grassland (A) : These two species are predators that hunt in the same environment and likely compete for the same prey. This is an example of competition (I).

- A cuckoo laying an egg in a crow's nest (B) : The cuckoo is known for laying its eggs in the nests of other birds, such as crows. The crow then raises the cuckoo's young, often at the expense of its own offspring. This is a form of brood parasitism (II).

- Fungi and the root of a higher plant in mycorrhizae (C) : Mycorrhizae are symbiotic relationships between fungi and plant roots, in which the fungi help the plant absorb water and nutrients from the soil, while the plant provides the fungi with carbohydrates. This is an example of mutualism (III).

- A cattle egret and a cattle in a field (D) : Cattle egrets are often seen near cattle, feeding on the insects that the cattle stir up as they move and graze. The egret benefits from this interaction (by getting easy access to food), while the cattle are unaffected. This is an example of commensalism (IV).

Given this information, the correct match is :

Option D :

A-I, B-II, C-III, D-IV
Q.55

Match List I with List II.

List I List II
(A) Logistic growth (I) Unlimited resource availability condition
(B) Exponential growth (II) Limited resource availability condition
(C) Expanding age pyramid (III) The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups
(D) Stable age pyramid (IV) The percent individuals of pre-reproductive and reproductive age group are same

Choose the correct answer from the options given below:

(A)
A-II, B-III, C-I, D-IV
(B)
A-II, B-IV, C-I, D-III
(C)
A-II, B-IV, C-III, D-I
(D)
A-II, B-I, C-III, D-IV
(D)

Solution

- Logistic growth (A) is a type of population growth that occurs under conditions of limited resources (II).

- Exponential growth (B) is a type of population growth that occurs under conditions of unlimited resources (I).

- An expanding age pyramid (C) represents a population where the percentage of individuals in the pre-reproductive age group is the largest, followed by the reproductive and post-reproductive age groups (III).

- A stable age pyramid (D) represents a population where the percentage of individuals in the pre-reproductive and reproductive age groups are approximately equal (IV).

So, the correct match is :

A-II, B-I, C-III, D-IV.
Q.56

The thickness of ozone in a column of air in the atmosphere is measured in terms of :

(A)
Decibels
(B)
Decameter
(C)
Kilobase
(D)
Dobson units
(D)

Solution

The thickness of the ozone in a column of air from the ground to the top of the atmosphere is measured in terms of Dobson units (DU). Noise is measured in decibels.

Q.57

Which of the following statements is correct?

(A)
Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
(B)
Presence of large amount of nutrients in water restricts ‘Algal Bloom’
(C)
Algal Bloom decreases fish mortality
(D)
Eutrophication refers to increase in domestic sewage and waste water in lakes.
(A)

Solution

Biomagnification, also known as bioaccumulation, is the increasing concentration of a substance, such as a toxic chemical, in the tissues of organisms at successively higher levels in a food chain. As you move up the food chain, from producer organisms to top carnivores, the concentration of the toxic substance increases. This is because the substance is not easily broken down or excreted, and so it accumulates in organisms' tissues.

The other options are incorrect. Algal blooms are often caused by an excess of nutrients, particularly nitrogen and phosphorus, in water (Option B). Algal blooms can lead to increased fish mortality, not decreased (Option C). Eutrophication refers to the process of nutrient enrichment in a water body leading to excessive growth of plants and algae, often due to runoff from the land, which causes a dense growth of plant life (Option D). While domestic sewage and wastewater can contribute to eutrophication, the term eutrophication does not refer specifically to the increase in these substances in lakes.
Q.58

Given below are two statements:

Statement I: Electrostatic precipitator is most widely used in thermal power plant.

Statement II : Electrostatic precipitator in thermal power plant removes ionising radiations.

In the light of the above statements, choose the most appropriate answer from the options given below:

(A)
Both Statement I and Statement II are incorrect.
(B)
Statement I is correct but Statement II is incorrect.
(C)
Statement I is incorrect but Statement II is correct.
(D)
Both Statement I and Statement II are correct.
(B)

Solution

Electrostatic precipitator is most widely used in thermal power plants.

It can remove over 99 percent particulate matter present in the exhaust from a thermal power plant.

Q.59

Identify the pair of heterosporous pteridophytes among the following :

(A)
Selaginella and Salvinia
(B)
Psilotum and Salvinia
(C)
Equisetum and Salvinia
(D)
Lycopodium and Selaginella
(A)

Solution

Selaginella and Salvinia are heterosporous pteridophytes. They produces two different kind of spores. Psilotum, Lycopodium and Equisetum are homosporous pteridophytes.

Q.60

Given below are two statements : One labelled as Assertion A and the other labelled as Reason R:

Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.

Reason R : Protonema develops directly from spores produced in capsule.

In the light of the above statements, choose the most appropriate answer from options given below:

(A)
Both A and R are correct but R is NOT the correct explanation of A
(B)
A is correct but R is not correct
(C)
A is not correct but R is correct
(D)
Both A and R are correct and R is the correct explanation of A
(D)

Solution

The life cycle of mosses consists of two stages: the gametophyte stage and the sporophyte stage.

Assertion A states : "The first stage of the gametophyte in the life cycle of moss is the protonema stage." This statement is correct. After a spore germinates, it forms a mass of green, branched, one-cell-thick filaments known as the protonema, which is indeed the first stage of the gametophyte generation in mosses.

Reason R states : "Protonema develops directly from spores produced in the capsule." This statement is also correct. The spores are produced in a capsule, which is the sporophyte part of the moss life cycle. When these spores are released and germinate, they grow into the protonema.

Not only are both statements correct, but Reason R provides a correct explanation for Assertion A.

Therefore, the answer is :

Option D : Both A and R are correct and R is the correct explanation of A.
Q.61

Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period, that leads early seed production?

(A)
Gibberellic Acid
(B)
Zeatin
(C)
Abscisic Acid
(D)
Indole-3-butyric Acid
(A)

Solution

Gibberellic acid (GA) is a plant hormone that stimulates cell elongation, germination, and influences a variety of developmental processes, including maturation and seed production. In the forestry industry, it is often used to hasten the maturity period and stimulate early seed production in juvenile conifers.
Q.62

Which hormone promotes internode/petiole elongation in deep water rice?

(A)
Kinetin
(B)
Ethylene
(C)
2, 4-D
(D)
GA3
(B)

Solution

The hormone that promotes internode/petiole elongation in deep water rice is Ethylene.

Ethylene is a plant hormone that plays a critical role in growth and development, including responses to environmental stimuli. In the case of deep water rice, when the plants are submerged, the ethylene concentration increases and promotes rapid internodal elongation, which allows the plant to keep its leaves above the water surface.

So, the correct answer is Option B - Ethylene.

Q.63

Identify the correct statements :

A. Detrivores perform fragmentation.

B. The humus is further degraded by some microbes during mineralization.

C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.

D. The detritus food chain begins with living organisms.

E. Earthworms break down detritus into smaller particles by a process called catabolism.

Choose the correct answer from the options given below :

(A)
B, C, D only
(B)
C, D, E only
(C)
D, E, A only
(D)
A, B, C only
(D)

Solution

Let's evaluate each statement:

A. Detrivores perform fragmentation.

  • This statement is true. Detrivores, such as earthworms and beetles, break down detritus (dead organic material) into smaller pieces in a process called fragmentation.

B. The humus is further degraded by some microbes during mineralization.

  • This statement is true. Microbes, including bacteria and fungi, break down humus into inorganic nutrients in a process called mineralization.

C. Water-soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.

  • This statement is true. Leaching refers to the process where nutrients are washed away from the soil into lower layers or into bodies of water.

D. The detritus food chain begins with living organisms.

  • This statement is false. The detritus food chain begins with dead organic material or detritus, not living organisms.

E. Earthworms break down detritus into smaller particles by a process called catabolism.

  • This statement is false. The process by which earthworms break down detritus into smaller particles is called fragmentation, not catabolism. Catabolism refers to the breakdown of complex molecules in living organisms to form simpler ones, along with the release of energy.

Therefore, the correct answer is :

Option D : A, B, C only.

Q.64

In the equation GPP R = NPP

GPP is Gross Primary Productivity

NPP is Net Primary Productivity

R here is __________.

(A)
Respiratory quotient
(B)
Respiratory loss
(C)
Reproductive allocation
(D)
Photosynthetically active radiation
(B)

Solution

In the equation GPP - R = NPP,

GPP stands for Gross Primary Productivity, NPP stands for Net Primary Productivity, and R represents the energy used by plants for their own metabolic processes, which is also known as Respiratory loss.

Q.65

Which one of the following statements is NOT correct?

(A)
Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries
(B)
Water hyacinth grows abundantly in eutrophic water bodies and leads to an imbalance in the ecosystem dynamics of the water body
(C)
The amount of some toxic substances of industrial waste water increases in the organisms at successive trophic levels
(D)
The micro-organisms involved in biodegradation of organic matter in a sewage polluted water body consume a lot of oxygen causing the death of aquatic organisms
(A)

Solution

Algal bloom imparts a distinct colour to the water bodies. It causes deterioration of the water quantity and fish mortality.

Q.66

Match List I with List II:

List I
(Interaction)
List II
(Species A and B)
(A) Mutualism (I) +(A), 0(B)
(B) Commensalism (II) (A), 0(B)
(C) Amensalism (III) +(A), (B)
(D) Parasitism (IV) +(A), +(B)

Choose the correct answer from the options given below:

(A)
A-IV, B-I, C-II, D-III
(B)
A-IV, B-III, C-I, D-II
(C)
A-III, B-I, C-IV, D-II
(D)
A-IV, B-II, C-I, D-III
(A)

Solution

(+, +) Mutualism : In this interaction, both the interacting species are benefitted.

(+, 0) Commensalism : Only one species is benefitted and the other species remains unharmed.

(, 0) Amensalism : Neither species is benefitted. One remains unharmed and the other is harmed.

(+, ) Parasitism : One species is benefitted and other is negatively effected.

Q.67

Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

(A)
Gonorrhoea
(B)
Hepatitis-B
(C)
HIV Infection
(D)
Genital herpes
(A)

Solution

Gonorrhoea is a sexually transmitted disease caused by the bacterium Neisseria gonorrhoeae. It can be effectively treated with antibiotics, especially when detected early.

Hepatitis B, HIV Infection, and Genital Herpes are caused by viruses. These viral infections can be managed with antiviral therapy but they are typically not completely curable.

So, the correct answer is :

Option A : Gonorrhoea

Q.68

Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?

(A)
Serum and Urine analysis
(B)
Polymerase Chain Reaction (PCR) technique
(C)
Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
(D)
Recombinant DNA Technology
(A)

Solution

The correct answer is option (A) because using conventional methods of diagnosis like serum and urine analysis, etc, do not help in early diagnosis. Recombinant DNA technology, Polymerase Chain Reaction [PCR] and Enzyme Linked Immuno-Sorbent Assay (ELISA) are some of the techniques that serve the purpose of early diagnosis.

Q.69

In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?

(A)
B-lymphocytes
(B)
Basophils
(C)
Eosinophils
(D)
TH cells
(D)

Solution

HIV, or the Human Immunodeficiency Virus, primarily infects CD4+ T cells, which are a type of T cell. In the context of the options given, TH cells, or T helper cells, are a subset of CD4+ T cells.

So, the correct answer is :

Option D : TH cells
Q.70

Match List I with List II.

List I List II
(A) Heroin (I) Effect on cardiovascular system
(B) Marijuana (II) Slow down body function
(C) Cocaine (III) Painkiller
(D) Morphine (IV) Interfere with transport of dopamine

Choose the correct answer from the options given below:

(A)
A-I, B-II, C-III, D-IV
(B)
A-IV, B-III, C-II, D-I
(C)
A-III, B-IV, C-I, D-II
(D)
A-II, B-I, C-IV, D-III
(D)

Solution

The correct answer is option (D) as

Heroin belongs to the category of opioids and it is a depressant that slows down body functions.

Marijuana is known for its effect on the cardiovascular system of the body.

Cocaine interferes with the transport of the neurotransmitter dopamine.

Morphine is used is a sedative and painkiller.

Q.71

Match List I with List II.

List I List II
(A) Ringworm (I) Haemophilus influenzae
(B) Filariasis (II) Trichophyton
(C) Malaria (III) Wuchereria bancrofti
(D) Pneumonia (IV) Plasmodium vivax

Choose the correct answer from the options given below:

(A)
A-II, B-III, C-I, D-IV
(B)
A-III, B-II, C-I, D-IV
(C)
A-III, B-II, C-IV, D-I
(D)
A-II, B-III, C-IV, D-I
(D)

Solution

The diseases listed in List I are caused by the organisms listed in List II :

- Ringworm is caused by the fungus Trichophyton.

- Filariasis is caused by the parasite Wuchereria bancrofti.

- Malaria is caused by the protozoan Plasmodium species (including Plasmodium vivax).

- Pneumonia can be caused by a variety of organisms, including the bacterium Haemophilus influenzae.

Therefore, the correct answer is :

Option D : A-II, B-III, C-IV, D-I
Q.72

Match List I with List II.

List I List II
(A) P-wave (I) Beginning of systole
(B) Q-wave (II) Repolarisation of ventricles
(C) QRS complex (III) Depolarisation of atria
(D) T-wave (IV) Depolarisation of ventricles

Choose the correct answer from the options given below :

(A)
A-IV, B-III, C-II, D-I
(B)
A-II, B-IV, C-I, D-III
(C)
A-I, B-II, C-III, D-IV
(D)
A-III, B-I, C-IV, D-II
(D)

Solution

- P-wave: Depolarisation of atria

- Q-wave: Beginning of systole

- QRS complex: Depolarisation of ventricles

- T-wave: Repolarisation of ventricles
Q.73

Which of the following statements are correct?

A. Basophils are most abundant cells of the total WBCs

B. Basophils secrete histamine, serotonin and heparin

C. Basophils are involved in inflammatory response

D. Basophils have kidney shaped nucleus

E. Basophils are agranulocytes

Choose the correct answer from the options given below:

(A)
C and E only
(B)
B and C only
(C)
A and B only
(D)
D and E only
(B)

Solution

The correct answer is Option B : B and C only.

Statement A is incorrect. Basophils are actually the least abundant cells of the total white blood cells (WBCs), not the most abundant.

Statement B is correct. Basophils do secrete histamine, serotonin, and heparin. Histamine and serotonin are involved in inflammatory response, while heparin is an anticoagulant.

Statement C is also correct. Basophils are involved in the inflammatory response. They release chemicals such as histamine and serotonin that dilate blood vessels and attract other white blood cells to the site of inflammation.

Statement D is incorrect. Basophils do not have a kidney-shaped nucleus. That description is more appropriate for monocytes, another type of white blood cell.

Statement E is incorrect. Basophils are not agranulocytes. They are granulocytes, a category of white blood cells characterized by the presence of granules in their cytoplasm. Agranulocytes, which lack visible cytoplasmic granules, include lymphocytes and monocytes.

Q.74

Match List I with List II.

List I
(Type of Joint)
List II
(Found between)
(A) Cartilaginous Joint (I) Between flat skull bones
(B) Ball and Socket Joint (II) Between adjacent vertebrae in vertebral column
(C) Fibrous Joint (III) Between carpal and metacarpal of thumb
(D) Saddle joint (IV) Between Humerus and Pectoral girdle

Choose the correct answer from the options given below:

(A)
A-II, B-IV, C-I, D-III
(B)
A-I, B-IV, C-III, D-II
(C)
A-II, B-IV, C-III, D-I
(D)
A-III, B-I, C-II, D-IV
(A)

Solution

A) Cartilaginous Joint : These joints are connected by cartilage and allow limited movement. They are found between adjacent vertebrae in the vertebral column.

B) Ball and Socket Joint : These joints consist of a ball-like structure fitting into a socket, allowing for a wide range of movement. They are found between the humerus and the pectoral girdle.

C) Fibrous Joint : These joints are connected by fibrous connective tissue and allow little or no movement. They are found between flat skull bones.

D) Saddle Joint : These joints have two bones with concave and convex surfaces that fit together, allowing movement in two planes. They are found between the carpal and metacarpal of the thumb.

So, the correct matching is :

A-II, B-IV, C-I, D-III

Q.75

Which of the following statements are correct regarding skeletal muscle?

A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.

B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.

C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.

D. M line is considered as functional unit of contraction called sarcomere.

Choose the most appropriate answer from the options given below:

(A)
B and C only
(B)
A, C and D only
(C)
C and D only
(D)
A, B and C only
(A)

Solution

Option (A) is the correct answer because statements B and C are only correct statements while A and D are incorrect statements.

Muscle bundles are held together by collagenous connective tissue layer called fascia. Muscle bundles are called fascicles. The portion of the myofibril between two successive ‘Z’ lines is considered as functional unit of contraction called sarcomere.

Q.76

Match List I with List II with respect to human eye.

List I List II
(A) Fovea (I) Visible coloured portion of eye that regulates diameter of pupil.
(B) Iris (II) External layer of eye formed of dense connective tissue.
(C) Blind spot (III) Point of greatest visual acuity or resolution.
(D) Sclera (IV) Point where optic nerve leaves the eyeball and photoreceptor cells are absent.

Choose the correct answer from the options given below:

(A)
A-IV, B-III, C-II, D-I
(B)
A-I, B-IV, C-III, D-II
(C)
A-II, B-I, C-III, D-IV
(D)
A-III, B-I, C-IV, D-II
(D)

Solution

Option (B) is the correct answer because

(i) Fovea is the point of greatest visual acuity or resolution.

(ii) Iris is the visible coloured portion of the eye that regulates diameter of pupil.

(iii) Blind spot is the point where optic nerve leaves the eye-ball and photoreceptor cells are absent.

(iv) Sclera is the external layer of eye formed of dense connective tissue.

Q.77

The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are:

(A)
Corpora quadrigemina and hippocampus
(B)
Brain stem and epithalamus
(C)
Corpus callosum and thalamus
(D)
Limbic system and hypothalamus
(D)

Solution

The limbic system, which includes structures such as the amygdala and hippocampus, plays a significant role in regulating emotions, including fear, pleasure, and anger. The hypothalamus, another component of the limbic system, is involved in various functions, including the regulation of sexual behavior and responses to pleasure and excitement. Therefore, option D is correct.

Option (A), (B) and (C) are not correct because corpora quadrigemina is a part of the midbrain and consists of four round swellings. Corpus callosum is a tract of nerve fibres that connects right and left cerebral hemispheres. Thalamus is a major coordinating centre in the forebrain for sensory and motor signalling. Midbrain, pons and medulla oblongata together form the brain stem.

Q.78

Axile placentation is observed in

(A)
China rose, Beans and Lupin
(B)
Tomato, Dianthus and Pea
(C)
China rose, Petunia and Lemon
(D)
Mustard, Cucumber and Primrose
(C)

Solution

China rose, Tomato, Petunia and Lemon show axile placentation.

Dianthus and Primrose show free central placentation.

Pea, Lupin and Beans show marginal placentation.

Cucumber and mustard show parietal placentation.

Q.79

Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R.

Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.

Reason R : Ban on amniocentesis checks increasing menace of female foeticide.

In the light of the above statements, choose the correct answer from the options given below.

(A)
Both A and R are true and R is NOT the correct explanation of A.
(B)
A is true but R is false.
(C)
A is false but R is true.
(D)
Both A and R are true and R is the correct explanation of A.
(C)

Solution

The correct answer is Option C : A is false but R is true.

Assertion A is false because amniocentesis for sex determination is not a part of the Reproductive and Child Health Care Programme. In fact, the use of amniocentesis for the purpose of sex determination is illegal in many countries, including India, due to its association with sex-selective abortions and the societal preference for male children.

Reason R is true because a ban on amniocentesis for sex determination is indeed implemented in an attempt to reduce the incidence of female foeticide. The misuse of this medical procedure for sex-selective abortions has led to a gender imbalance in some societies, thus the need for regulatory measures.

Q.80

Match List I with List II.

List I List II
(A) Vasectomy (I) Oral method
(B) Coitus interruptus (II) Barrier method
(C) Cervical caps (III) Surgical method
(D) Saheli (IV) Natural method

Choose the correct answer from the options given below:

(A)
A-III, B-IV, C-II, D-I
(B)
A-II, B-III, C-I, D-IV
(C)
A-IV, B-II, C-I, D-III
(D)
A-III, B-I, C-IV, D-II
(A)

Solution

A) Vasectomy : A surgical method of male sterilization that involves cutting or sealing the vas deferens to prevent sperm from entering the semen.

B) Coitus interruptus : A natural method of contraception that involves withdrawing the penis from the vagina before ejaculation to prevent sperm from entering the vagina.

C) Cervical caps : A barrier method of contraception that covers the cervix to prevent sperm from entering the uterus.

D) Saheli : An oral method of contraception that involves taking a non-steroidal, non-hormonal birth control pill.

So, the correct matching is: A-III, B-IV, C-II, D-I

Q.81

Given below are two statements:

Statement I : Ligaments are dense irregular tissue.

Statement II : Cartilage is dense regular tissue.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are false
(B)
Statement I is true but Statement II is false
(C)
Statement I is false but Statement II is true
(D)
Both Statement I and Statement II are true
(A)

Solution

The correct answer is Option A : Both Statement I and Statement II are false.

Explanation : Ligaments are a type of dense regular connective tissue, not irregular. They connect bones to other bones, providing stability and support.

On the other hand, cartilage is a type of specialized connective tissue that is not classified as dense. It's composed of cells called chondrocytes which are embedded in a matrix of collagen and elastic fibers. It's neither dense regular nor dense irregular tissue.

Therefore, both statements I and II are incorrect.

Q.82

Match List I with List II.

List I List II
(A) Mast cells (I) Ciliated epithelium
(B) Inner surface of bronchiole (II) Areolar connective tissue
(C) Blood (III) Cuboidal epithelium
(D) Tubular parts of nephron (IV) Specialised connective tissue

Choose the correct answer from the options give below:

(A)
A-II, B-III, C-I, D-IV
(B)
A-II, B-I, C-IV, D-III
(C)
A-III, B-IV, C-II, D-I
(D)
A-I, B-II, C-IV, D-III
(B)

Solution

- Mast cells (A) : These are a type of white blood cell that is part of the immune system. They are found in many tissues, but particularly in areas close to the external environment, such as the skin and mucous membranes. They are found in connective tissues like areolar tissue.

- Inner surface of bronchiole (B) : The bronchioles are small airways in the respiratory tract that lead to the alveoli (tiny air sacs in the lungs). The inner surface of bronchioles is lined with ciliated epithelium. Cilia are small, hair-like structures that help move mucus and trapped particles out of the lungs.

- Blood (C) : This is a specialized type of connective tissue. It has cells (red and white blood cells, and platelets) suspended in a liquid matrix called plasma.

- Tubular parts of nephron (D) : Nephrons are the functional units of the kidney, responsible for filtering blood and creating urine. The tubular parts of the nephron are lined with cuboidal epithelium. This type of epithelial tissue has cells that are roughly as tall as they are wide.

Given this information, the correct match seems to be :

Option B :

A-II, B-I, C-IV, D-III
Q.83

In cockroach, excretion is brought about by -

A. Phallic gland

B. Urecose gland

C. Nephrocytes

D. Fat body

E. Collaterial glands

Choose the correct answer from the options given below :

(A)
A, B and E only
(B)
B, C and D only
(C)
B and D only
(D)
A and E only
(B)

Solution

Option (B) is the answer because,

In cockroaches, excretion is primarily accomplished by Malpighian tubules, which are not listed in the provided options. However, among the provided options, urecose glands, nephrocytes, and the fat body do participate in excretory processes to some degree.

Urecose glands are present in male cockroach of some species. They synthesise uric acid. Nephrocytes are large, colourless, ovoid, binucleate cells attached to the dorsal diaphragm in the body cavity. Fat body accumulates, produces and stores uric acid.

Phallic gland is the structure of male reproductive system of cockroach and it secretes the outer layer of spermatophore. Collaterial gland is the structure of female reproductive system of cockroach and it secretes the hard egg-case or ootheca around fertilised eggs.

Q.84

Which of the following is characteristic feature of cockroach regarding sexual dimorphism?

(A)
Presence of anal styles
(B)
Presence of sclerites
(C)
Presence of anal cerci
(D)
Dark brown body colour and anal cerci
(A)

Solution

Option (A) is the correct answer because anal styles are present in male cockroaches and absent in female cockroaches.

Option (B), (C) and (D) are not the correct answers because sclerites, anal cerci and dark brown body colour are common features of both male and female cockroaches.

Q.85

Match List I with List II

List I
(Cells)
List II
(Secretion)
(A) Peptic cells (I) Mucus
(B) Goblet cells (II) Bile juice
(C) Oxyntic cells (III) Proenzyme pepsinogen
(D) Hepatic cells (IV) HCl and intrinsic factor for absorption of vitamin B

Choose the correct answer from the options given below:

(A)
A-II, B-I, C-III, D-IV
(B)
A-III, B-I, C-IV, D-II
(C)
A-II, B-IV, C-I, D-III
(D)
A-IV, B-III, C-II, D-I
(B)

Solution

Option (B) is the correct answer because gastric glands have three major types of cells namely-

(i) Mucus neck cells which secrete mucus

(ii) Peptic or chief cells which secrete the proenzyme pepsinogen

(iii) Parietal or oxyntic cells which secrete HCl and intrinsic factor for absorption of vitamin B12.

Q.86

Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by

(A)
Ileo-caecal valve
(B)
Gastro-oesophageal sphincter
(C)
Pyloric sphincter
(D)
Sphincter of Oddi
(A)

Solution

Option (A) is the correct answer because the undigested food (faeces) enters into caecum of the large intestine through ileo-caecal valve, which prevents the backflow of the faecal matter.

Option (B) is not the answer because a muscular sphincter i.e., the gastro-oesophageal sphincter regulates the opening of oesophagus into the stomach.

Option (C) is not the answer because pyloric sphincter regulates the opening in between stomach and duodenum.

Option (D) is not the answer because the opening of common hepato-pancreatic duct is guarded by sphincter of Oddi.

Q.87

Match List I with List II.

List I List II
(A) CCK (I) Kidney
(B) GIP (II) Heart
(C) ANF (III) Gastric gland
(D) ADH (IV) Pancreas

Choose the correct answer from the options given below :

(A)
A-III, B-II, C-IV, D-I
(B)
A-II, B-IV, C-I, D-III
(C)
A-IV, B-II, C-III, D-I
(D)
A-IV, B-III, C-II, D-I
(D)

Solution

The correct answer is option (D) as

Cholecystokinin (CCK) acts on both gall bladder and pancreas and stimulates the secretion of bile juice and pancreatic enzymes respectively.

GIP inhibits gastric secretion and motility.

Atrial Natriuretic Factor (ANF) is released from the atrial wall of our heart.

Anti-diuretic hormone (ADH) acts mainly on the kidney and stimulates resorption of water and electrolytes by the distal tubules.

Q.88

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.

Assertion A : Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla.

Reason R : Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.

In the light of the above statements, choose the correct answer from the options given below :

(A)
Both A and R are true but R is NOT the correct explanation of A.
(B)
A is true but R is false.
(C)
A is false but R is true.
(D)
Both A and R are true and R is the correct explanation of A.
(B)

Solution

The correct answer is :

Option B : A is true but R is false.

Explanation :

Assertion A is correct. In the kidney, nephrons, the functional units responsible for filtration, reabsorption, and secretion processes, are indeed of two types: cortical and juxta-medullary. These types are classified based on their location within the kidney; cortical nephrons are primarily located in the cortex, while juxta-medullary nephrons are located near the junction between the cortex and medulla.

However, Reason R is incorrect. The assertion that juxta-medullary nephrons have short loops of Henle, while cortical nephrons have longer loops of Henle is false. In fact, it's the opposite. Juxta-medullary nephrons have longer loops of Henle which extend deep into the medulla. This allows them to concentrate urine more effectively than cortical nephrons, whose loops of Henle are shorter and do not extend as deep into the medulla.

Q.89

Match List I with List II.

List I List II
(A) Taenia (I) Nephridia
(B) Paramoecium (II) Contractile vacuole
(C) Periplaneta (III) Flame cells
(D) Pheretima (IV) Urecose gland

Choose the correct answer from the options given below :

(A)
A-I, B-II, C-IV, D-III
(B)
A-III, B-II, C-IV, D-I
(C)
A-II, B-I, C-IV, D-III
(D)
A-I, B-II, C-III, D-IV
(B)

Solution

The correct answer should be Option B : A-III, B-II, C-IV, D-I.

Explanation :

A) Taenia (a genus of tapeworm) has flame cells as its excretory organs.

B) Paramoecium, a unicellular protist, uses contractile vacuoles to excrete waste and excess water.

C) Periplaneta (the American cockroach) uses malpighian tubules for excretion, but "Urecose gland" is not a correct match. However, given the available options, it's the closest match.

D) Pheretima, a genus of earthworms, uses nephridia as excretory organs.

Q.90

Which of the following statements are correct?

A. An excessive loss of body fluid from the body switches off osmoreceptors.

B. ADH facilitates water reabsorption to prevent diuresis.

C. ANF causes vasodilation.

D. ADH causes increase in blood pressure.

E. ADH is responsible for decrease in GFR.

Choose the correct answer from the options given below:

(A)
B, C and D only
(B)
A, B and E only
(C)
C, D and E only
(D)
A and B only
(A)

Solution

Option (A) is the correct answer because statements B, C and D are true statements. ADH facilitates water reabsorption from DCT of nephron to prevent diuresis, which causes increase in blood pressure. ANF which is secreted by the heart is a vasodilator.

Options (B), (C) and (D) are not correct because statements A and E are false. Excessive loss of body fluid from the body switches on the osmoreceptors.

Q.91

Which of the following are NOT under the control of thyroid hormone?

A. Maintenance of water and electrolyte balance

B. Regulation of basal metabolic rate

C. Normal rhythm of sleep-wake cycle

D. Development of immune system

E. Support the process of RBCs formation

Choose the correct answer from the options given below:

(A)
B and C only
(B)
C and D only
(C)
D and E only
(D)
A and D only
(B)

Solution

Option (B) is the correct answer because thyroid hormones play an important role in the regulation of basal metabolic rate, maintenance of water and electrolyte balance and support the process of RBCs formation, whereas this hormone is not involved in regulating normal rhythm of sleep-wake cycle and development of immune system.

Q.92

Which of the following statements are correct regarding female reproductive cycle?

A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.

B. First menstrual cycle begins at puberty and is called menopause.

C. Lack of menstruation may be indicative of pregnancy.

D. Cyclic menstruation extends between menarche and menopause.

Choose the most appropriate answer from the options given below:

(A)
A and B only
(B)
A, B and C only
(C)
A, C and D only
(D)
A and D only
(C)

Solution

The correct statements regarding the female reproductive cycle are :

A. In non-primate mammals cyclical changes during reproduction are called the oestrus cycle.

C. Lack of menstruation may be indicative of pregnancy.

D. Cyclic menstruation extends between menarche and menopause.

Statement B is incorrect because the first menstrual cycle that begins at puberty is called menarche, not menopause. Menopause is the end of the menstrual cycle and fertility in women, typically occurring in middle to old age.

So, the correct option is :

Option C : A, C and D only

Q.93

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.

Assertion A: Endometrium is necessary for implantation of blastocyst.

Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both A and R are true but R is NOT the correct explanation of A.
(B)
A is true but R is false.
(C)
A is false but R is true.
(D)
Both A and R are true and R is the correct explanation of A.
(A)

Solution

Assertion A : True. The endometrium is the inner lining of the uterus and it is where the blastocyst (a very early stage of an embryo) implants and develops during pregnancy.

Reason R : True. The corpus luteum is a temporary structure in the ovaries that produces progesterone, a hormone necessary for maintaining the endometrium. If fertilization does not occur, the corpus luteum degenerates, progesterone levels drop, and the endometrium disintegrates and is shed during menstruation.

However, Reason R is not a direct explanation of Assertion A, they are two separate facts about the endometrium.

So, the correct answer is :

Option A : Both A and R are true but R is NOT the correct explanation of A.
Q.94

Given below are two statements:

Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.

Statement Il: The cavity of the cervix is called cervical canal which along with vagina forms birth canal.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are false.
(B)
Statement I is correct but Statement II is false.
(C)
Statement I is incorrect but Statement II is true.
(D)
Both Statement I and Statement II are true.
(D)

Solution

Statement I is correct because the vas deferens does indeed receive a duct from the seminal vesicle. This combined structure is known as the ejaculatory duct, and it does open into the urethra, which carries semen out of the body during ejaculation.

Statement II is also correct. The cavity of the cervix is indeed referred to as the cervical canal. The cervix, along with the vagina, does form the birth canal, which is the path through which a baby travels during childbirth.
Q.95

Radial symmetry is NOT found in adults of phylum ______.

(A)
Hemichordata
(B)
Coelenterata
(C)
Echinodermata
(D)
Ctenophora
(A)

Solution

Radial symmetry is a type of symmetry where an organism can be divided into similar halves by more than two planes passing through the central axis. This type of symmetry is found in organisms that tend to meet their environment in all directions, such as aquatic animals.

1. Hemichordata : Adult organisms in this phylum, which includes acorn worms, pterobranchs, and graptolites, exhibit bilateral symmetry. This means they can be divided into two identical halves only along a single plane. Hence, radial symmetry is not found in the adults of this phylum.

2. Coelenterata (also known as Cnidaria) : This phylum includes jellyfish, sea anemones, and corals. They exhibit radial symmetry. So, radial symmetry is found in this phylum.

3. Echinodermata : Adult organisms in this phylum, which includes starfish, sea urchins, and sea cucumbers, exhibit radial symmetry. However, it's important to note that their larvae exhibit bilateral symmetry. Therefore, radial symmetry is found in adults of this phylum.

4. Ctenophora (also known as comb jellies) : These marine animals also exhibit radial symmetry. Thus, radial symmetry is found in this phylum.
Q.96

Select the correct statements with reference to chordates.

A. Presence of a mid-dorsal, solid and double nerve cord.

B. Presence of closed circulatory system.

C. Presence of paired pharyngeal gill slits.

D. Presence of dorsal heart

E. Triploblastic pseudocoelomate animals.

Choose the correct answer from the options given below:

(A)
B and C only
(B)
B, D and E only
(C)
C, D and E only
(D)
A, C and D only
(A)

Solution

Chordates are defined by having certain specific anatomical features at some point during their development. The correct attributes of chordates are:

1. Presence of a dorsal, hollow nerve cord (not a mid-dorsal, solid and double nerve cord as mentioned in statement A)

2. Presence of a closed circulatory system.

3. Presence of paired pharyngeal gill slits.

4. Presence of a post-anal tail.

5. Presence of a notochord.

Regarding the other statements :

- The heart of chordates is ventral, not dorsal (as in statement D).

- Chordates are triploblastic and coelomate, not pseudocoelomate (as in statement E).

So, based on these facts, the correct answer is :

Option A : B and C only.
Q.97

The unique mammalian characteristics are :

(A)
hairs, pinna and mammary glands
(B)
hairs, pinna and indirect development
(C)
pinna, monocondylic skull and mammary glands
(D)
hairs, tympanic membrane and mammary glands
(A)

Solution

Unique mammalian characteristics include:

1. Hair or fur: Mammals are the only animals that have hair. This hair helps to insulate the body to maintain a constant body temperature.

2. Mammary glands: These are glands that, in females, produce milk for the nourishment of young ones. This is a characteristic feature of all mammals and is, in fact, the feature that gives this group its name.

3. The presence of pinnae (external ears): Most mammals have pinnae that help to collect and direct sound waves into the ear.

Option B is incorrect because indirect development is not a unique characteristic of mammals; many animals, including certain insects, amphibians, and fishes, undergo indirect development.

Option C is incorrect because a monocondylic skull, in which the skull only articulates with the first vertebra via a single condyle, is a characteristic of some reptiles and amphibians, not mammals. Mammals possess a dicondylic skull, with two occipital condyles.

Option D is incorrect because while mammals do have a tympanic membrane (ear drum), it is not unique to mammals; other vertebrate groups, such as birds and reptiles, also have a tympanic membrane.

So, the correct answer is :

Option A : hairs, pinna and mammary glands.
Q.98

Vital capacity of lung is ________.

(A)
IRV + ERV + TV + RV
(B)
IRV + ERV + TV – RV
(C)
IRV + ERV + TV
(D)
IRV + ERV
(C)

Solution

The vital capacity (VC) of the lung is the maximum amount of air a person can expel from the lungs after a maximum inhalation. It is equal to the sum of inspiratory reserve volume (IRV), tidal volume (TV), and expiratory reserve volume (ERV).

nspiratory reserve volume (IRV) is the amount of air that can be inhaled beyond a normal breath.

Expiratory reserve volume (ERV) is the amount of air that can be exhaled beyond a normal breath.

Tidal volume (TV) is the amount of air that is inhaled and exhaled during a normal breath.

Therefore, vital capacity (VC) = IRV + ERV + TV.
Q.99

Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.

(A)
Numbat, Spotted cuscus, Flying phalanger
(B)
Mole, Flying squirrel, Tasmanian tiger cat
(C)
Lemur, Anteater, Wolf
(D)
Tasmanian wolf, Bobcat, Marsupial mole
(A)

Solution

Option (A) is the correct answer because numbat, spotted cuscus and flying phalanger are Australian marsupials exhibiting adaptive radiation.

Option (B) is incorrect because mole and flying squirrel are placental mammals.

Option (C) is incorrect because lemur and wolf are placental mammals.

Option (D) is incorrect because bobcat is a placental mammal.

Q.100

Given below are two statements:

Statement I: RNA mutates at a faster rate.

Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are false.
(B)
Statement I is true but Statement II is false.
(C)
Statement I is false but Statement II is true.
(D)
Both Statement I and Statement II are true.
(D)

Solution

Statement I is true because RNA, particularly in RNA viruses, does mutate at a faster rate than DNA. This is largely due to the lack of proofreading mechanisms in RNA replication that are present in DNA replication.

Statement II is also true. Viruses with an RNA genome, like the influenza virus or HIV, can mutate and evolve faster. The high mutation rate of RNA, combined with the short generation time of viruses, leads to rapid evolution, allowing these viruses to quickly adapt to new environments or hosts.