NEET-UG 2024

NEET 2024

Physics (Maximum Marks: 200)
  • This section contains 50 questions.
  • Each question has FOUR options (A), (B), (C) and (D). ONLY ONE of these four options is the correct answer.
  • Full Marks : +4 If ONLY the correct option is chosen;
  • Zero Marks : 0 If none of the options is chosen (i.e. the question is unanswered);
  • Negative Marks : −1 In all other cases.
Q.1

In a vernier callipers, divisions of vernier scale coincide with divisions of main scale. If represents , the vernier constant (in ) is:

(A)
(B)
(C)
(D)
(B)

Solution

V.C = MSD VSD ..... (1)

given : MSD

..... (2)

From (1) and (2)

Q.2

The quantities which have the same dimensions as those of solid angle are:

(A)
strain and angle
(B)
stress and angle
(C)
strain and arc
(D)
angular speed and stress
(A)

Solution

Solid angle has dimensions

Strain has dimensions

Angle measured in radians is also dimensionless

Q.3

A force defined by acts on a particle at a given time . The factor which is dimensionless, if and are constants, is:

(A)
(B)
(C)
(D)
(B)

Solution

The force acting on a particle at a given time is defined as , where and are constants. We need to determine which factor is dimensionless if and are constants.

Using the principle of homogeneity of dimensions:

Q.4

The velocity time plot of the motion of a body is shown below:

NEET 2024 Physics - Motion in a Straight Line Question 7 English

The acceleration time graph that best suits this motion is :

(A)
NEET 2024 Physics - Motion in a Straight Line Question 7 English Option 1
(B)
NEET 2024 Physics - Motion in a Straight Line Question 7 English Option 2
(C)
NEET 2024 Physics - Motion in a Straight Line Question 7 English Option 3
(D)
NEET 2024 Physics - Motion in a Straight Line Question 7 English Option 4
(C)

Solution

Initially, the body has zero velocity and zero slope. Hence the acceleration would be zero initially. After that, the slope of v-t curve is constant and positive.

After some time, velocity becomes constant and acceleration is zero.

After that, the slope of v-t curve is constant and negative.

NEET 2024 Physics - Motion in a Straight Line Question 7 English Explanation

Q.5

A horizontal force is applied to a block as shown in figure. The mass of blocks and are and 3 respectively. The blocks slide over a frictionless surface. The force exerted by block on block is :

NEET 2024 Physics - Laws of Motion Question 6 English

(A)
Zero
(B)
4 N
(C)
6 N
(D)
10 N
(C)

Solution

Q.6

A particle moving with uniform speed in a circular path maintains:

(A)
Constant velocity
(B)
Constant acceleration
(C)
Constant velocity but varying acceleration
(D)
Varying velocity and varying acceleration
(D)

Solution

When a particle moves along a circular path with a uniform speed, it is important to understand the motion characteristics in terms of both velocity and acceleration. Velocity is a vector quantity which means it has both magnitude and direction, while acceleration is the rate of change of velocity with respect to time.

First, let's analyze the velocity:

Although the speed (magnitude of the velocity vector) remains constant in uniform circular motion, the direction of the velocity vector continuously changes as the particle progresses along the circle. Since velocity includes both the magnitude and the direction, any change in either results in a change in velocity. Consequently, in uniform circular motion, the velocity of the particle is not constant but varies due to the continuous change in direction.

Next, consider the acceleration:

In circular motion, there is always an acceleration directed towards the center of the circle, known as centripetal acceleration. This acceleration is responsible for changing the direction of the velocity vector, thereby keeping the particle moving in a circle, despite the speed being constant. The formula for centripetal acceleration is:

where is the speed of the particle and is the radius of the circle. This acceleration is always directed towards the center of the circle and varies with the square of the speed and inversely with the radius of the circle.

Therefore, given that both the velocity and acceleration change, the correct choice is:

Option D - Varying velocity and varying acceleration

It states that in uniform circular motion, both the velocity and acceleration of the particle vary – velocity due to continuous changes in direction and acceleration due to its consistent inward (centripetal) direction towards the center of the circle.

Q.7

At any instant of time , the displacement of any particle is given by ( unit) under the influence of force of . The value of instantaneous power is (in unit):

(A)
10
(B)
5
(C)
7
(D)
6
(A)

Solution

To find the instantaneous power delivered by a force, we can use the formula:

where is the power, is the force vector, and is the velocity vector of the particle.

In this question, the force exerted is given as a constant . Since no direction is specified, and the displacement is given in a scalar form, we assume the force acts along the direction of displacement. Therefore, we can treat the vectors as scalars for simplicity.

The displacement of the particle is given by:

The velocity, , is the derivative of displacement with respect to time. Deriving the displacement equation with respect to time gives:

The instantaneous power can now be calculated as:

Thus, the instantaneous power delivered by the force at any time is .

The correct answer is Option A: 10.

Q.8

Two bodies and of same mass undergo completely inelastic one dimensional collision. The body moves with velocity while body is at rest before collision. The velocity of the system after collision is . The ratio is

(A)
(B)
(C)
(D)
(B)

Solution

In a completely inelastic collision, the two bodies stick together and move with a common final velocity. Here, before the collision, body is moving with a velocity and body is at rest. The conservation of momentum must hold true because no external forces are acting on the system.

The momentum before the collision is only due to body since body is at rest. Therefore, the total initial momentum of the system is given by:

where:

  • and are the masses of bodies and respectively,

  • is the mass of each body,

  • is the velocity of body ,

  • is the velocity of body because it is initially at rest.

Since they undergo a completely inelastic collision, bodies and stick together after the collision and hence move with a common velocity . The total mass of the combined system post-collision is . The momentum after the collision is given by:

Applying the conservation of momentum (since no external force implies momentum is conserved), we equate and :

Dividing through by yields:

Thus, solving for the ratio gives:

Therefore, the ratio of to is , making the correct answer:

Option B:

Q.9

A bob is whirled in a horizontal plane by means of a string with an initial speed of . The tension in the string is . If speed becomes while keeping the same radius, the tension in the string becomes:

(A)
(B)
(C)
(D)
(B)

Solution

NEET 2024 Physics - Rotational Motion Question 10 English Explanation

Q.10

The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is . The length of the rod is nearly:

(A)
8.5 cm
(B)
17.5 cm
(C)
20.7 cm
(D)
72.0 cm
(A)

Solution

Q.11

A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is in the direction shown, which one of the following options is correct ( and are any highest and lowest points on the wheel, respectively)?

NEET 2024 Physics - Rotational Motion Question 9 English

(A)
Point moves slower than point
(B)
Point moves faster than point
(C)
Both the points and move with equal speed
(D)
Point has zero speed
(B)

Solution

In the case of pure rolling,

NEET 2024 Physics - Rotational Motion Question 9 English Explanation

The topmost point will have velocity while point i.e. lowest point will have zero velocity. Hence point moves faster than point .

Q.12

The mass of a planet is th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on that planet is:

(A)
(B)
(C)
(D)
(D)

Solution

The acceleration due to gravity (g) on a planet is given by the formula:

where:

  • is the universal gravitational constant,
  • is the mass of the planet, and
  • is the radius of the planet.

In this question, we know that:

  • The mass of the planet is of the mass of the earth , so .
  • The diameter of the planet is half that of earth. Since the diameter is twice the radius, a diameter half that of earth implies the radius is also half the radius of the earth . Therefore, .

Using the formula for acceleration due to gravity and substituting the above information:

Simplify the expression:

Knowing that is the acceleration due to gravity on Earth , we substitute this value into the equation:

Thus, the acceleration due to gravity on the planet is , which corresponds to:

Option D:

Q.13

The minimum energy required to launch a satellite of mass from the surface of earth of mass and radius in a circular orbit at an altitude of from the surface of the earth is:

(A)
(B)
(C)
(D)
(A)

Solution

Apply energy conservation,

Q.14

The maximum elongation of a steel wire of length if the elastic limit of steel and its Young's modulus, respectively, are and , is:

(A)
4 mm
(B)
0.4 mm
(C)
40 mm
(D)
8 mm
(A)

Solution

First, we need to find the maximum force that can be applied to the steel wire within its elastic limit. This force can be calculated using the given area under stress and the stress limit provided by the elastic limit of steel.

Let's assume the area of cross-section of the wire is . The force exerted can be given by:

where:

(Elastic limit of steel)

To calculate the elongation () under this force, we use Hooke's Law, which relates force, elongation, cross-sectional area, original length, and Young's modulus as follows:

where:

(Young's modulus of steel),

(original length of the wire).

Substituting for from the earlier expression and rearranging the formula, we get:

Thus, the maximum elongation of the wire within the elastic limit is .

The answer is: Option A - 4 mm.

Q.15

A thin flat circular disc of radius is placed gently over the surface of water. If surface tension of water is , then the excess force required to take it away from the surface is

(A)
19.8 mN
(B)
198 N
(C)
1.98 mN
(D)
99 N
(A)

Solution

NEET 2024 Physics - Properties of Matter Question 7 English Explanation

Q.16

A metallic bar of Young's modulus, and coefficient of linear thermal expansion , length and area of cross-section is heated from to without expansion or bending. The compressive force developed in it is :

(A)
(B)
(C)
(D)
(B)

Solution

Given the properties and conditions of the metallic bar, we are required to calculate the compressive force developed due to heating. Key inputs include the Young's modulus (E), coefficient of linear thermal expansion (α), change in temperature (), and the original dimensions of the bar.

First, compute the linear expansion of the bar if it were free to expand. The change in length () due to thermal expansion can be computed through the formula:

Given:

Thus:

This is the change in length that the bar would undergo if not constrained.

However, in this scenario, the bar is constrained and does not actually expand. This constraint induces a compressive stress (constrained thermal stress) in the bar, which can be calculated using the formula relating stress, Young's modulus, and strain:

Where the strain () under constrained conditions due to thermal expansion is:

Therefore:

This stress is the force per unit area. To find the compressive force, we need to multiply this stress by the cross-sectional area of the bar:

Thus, the compressive force developed in the bar is .

Hence, the correct answer is Option B:

Q.17

A thermodynamic system is taken through the cycle . The work done by the gas along the path is:

NEET 2024 Physics - Heat and Thermodynamics Question 16 English

(A)
Zero
(B)
30 J
(C)
90 J
(D)
60 J
(A)

Solution

Path is an isochoric process.

Work done by gas along path is zero.

Q.18

The following graph represents the - curves of an ideal gas (where is the temperature and the volume) at three pressures and compared with those of Charles's law represented as dotted lines.

NEET 2024 Physics - Heat and Thermodynamics Question 15 English

Then the correct relation is :

(A)
(B)
(C)
(D)
(D)

Solution

At same temperature, curve with higher volume corresponds to lower pressure.

(We draw a straight line parallel to volume axis to get this)

Q.19

If represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are

(A)
5 cm, 2 s
(B)
5 m, 2 s
(C)
5 cm, 1 s
(D)
5 m, 1 s
(B)

Solution

In the equation for simple harmonic motion (SHM), the general form can be used to identify the parameters of SHM, where:

  • A is the amplitude.
  • ω (omega) is the angular frequency.
  • φ (phi) is the phase constant.
  • t is the time.

Comparing the given equation with the standard form:

  • The amplitude A is 5 m, as that is the coefficient of sine in the equation.
  • The angular frequency ω is rad/s.

The angular frequency is related to the time period of the motion through the formula:

.

Given that , we can substitute and solve for :

Hence, the amplitude of the motion is 5 m and the time period is 2 s. Thus, the correct answer is:

Option B: 5 m, 2 s

Q.20

If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then the new time period of oscillation is times its original time period. Then the value of is:

(A)
(B)
(C)
(D)
4
(B)

Solution

The period of oscillation, , of a simple pendulum is determined by the formula:

where:

  • is the length of the pendulum
  • is the acceleration due to gravity

The mass of the bob does not factor into the equation for the period.

Let's first denote the original length of the pendulum as and the original period of oscillation as . Hence,

When the length of the pendulum is halved, the new length would be . Thus, the new period can be calculated as:

We are given that the new period is . Therefore, we can set up the equation:

To find the value of , we solve for :

Multiplying both sides by 2:

Simplify to:

Hence, the correct answer is:

Option B:

Q.21

A thin spherical shell is charged by some source. The potential difference between the two points and (in V) shown in the figure is:

(Take SI units)

NEET 2024 Physics - Electrostatics Question 9 English

(A)
(B)
(C)
(D)
Zero
(D)

Solution

For uniformly charged spherical shell,

Q.22

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.

Assertion A: The potential (V) at any axial point, at distance from the centre of the dipole of dipole moment vector of magnitude, , is .

(Take units)

Reason R: , where is the distance of any axial point, situated at from the centre of the dipole.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both A and R are true and R is the correct explanation of A.
(B)
Both A and R are true and R is NOT the correct explanation of A.
(C)
A is true but R is false.
(D)
A is false but R is true.
(C)

Solution

The potential at any point, at distance from centre of dipole

At axial point where

At axial point where

Q.23

The terminal voltage of the battery, whose emf is and internal resistance , when connected through an external resistance of as shown in the figure is:

NEET 2024 Physics - Current Electricity Question 14 English

(A)
4 V
(B)
6 V
(C)
8 V
(D)
10 V
(C)

Solution

NEET 2024 Physics - Current Electricity Question 14 English Explanation

Q.24

A wire of length '' and resistance is divided into 10 equal parts. The first 5 parts are connected in series while the next 5 parts are connected in parallel. The two combinations are again connected in series. The resistance of this final combination is:

(A)
(B)
(C)
(D)
(B)

Solution

To solve this problem, we first need to understand how the resistance changes when we cut the wire into equal parts and how it behaves when connected in different configurations (series and parallel).

Given:

  • Original length of the wire, .
  • Total resistance of the wire .
  • The wire is divided into 10 equal parts.

Resistance of each part:

Since the wire is divided into 10 equal parts, the length of each part is . Resistance is proportional to length (as long as the cross-sectional area and material of the wire remain constant). Therefore, the resistance of each part, denoted as , is th of the total resistance:

First 5 parts in series:

When resistors are connected in series, the total resistance is the sum of the individual resistances:

Next 5 parts in parallel:

When resistors are connected in parallel, the total resistance can be calculated using the reciprocal formula:

Thus,

Final combination in series:

The total resistance of the combination, where the series and parallel groups are again connected in series, will be:

Thus, the correct answer to the resistance of the final combination is:

Option B

Q.25

Two heaters and have power rating of and , respectively. Those two are first connected in series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:

(A)
(B)
(C)
(D)
(B)

Solution

To find the ratio of power outputs when two heaters with different power ratings are connected first in series and then in parallel, we need to understand how the total power output varies based on the type of connection.

Heater Specifications:

  • Power of heater A
  • Power of heater B

Scenario 1: Series Connection

When resistors (or heaters in this case) are connected in series, the total resistance () is the sum of the individual resistances ( and ).

Using the formula for electrical power: ,

where is power, is voltage, and is resistance, we can express the resistance of each heater as:

Substitute the given power values:

Then the total resistance for the series connection is:

The total power output in series () is:

Scenario 2: Parallel Connection

For parallel connections, the total resistance () is given by:

Reformulate to find :

And the total power output in parallel () is:

However, simplifying,

The ratio of powers is then:

Solving and simplifying,

Given that we know one ratio of the actual power values, we simplify further. For calculating power in simple terms, consider voltage to be normalized (taken out of the fraction):

Therefore, the ratio of the power outputs when the heaters are connected first in series and then in parallel is 2:9, which corresponds to Option B.

Q.26

Choose the correct circuit which can achieve the bridge balance.

(A)
NEET 2024 Physics - Current Electricity Question 13 English Option 1
(B)
NEET 2024 Physics - Current Electricity Question 13 English Option 2
(C)
NEET 2024 Physics - Current Electricity Question 13 English Option 3
(D)
NEET 2024 Physics - Current Electricity Question 13 English Option 4
(A)

Solution

In option (1),

The diode can conduct and have resistance because diode have dynamic resistance. In that case bridge will be balanced.

Q.27

In the following circuit, the equivalent capacitance between terminal A and terminal B is :

NEET 2024 Physics - Capacitor Question 8 English

(A)
2 F
(B)
1 F
(C)
0.5 F
(D)
4 F
(A)

Solution

NEET 2024 Physics - Capacitor Question 8 English Explanation 1

Given circuit is balanced Wheatstone bridge

NEET 2024 Physics - Capacitor Question 8 English Explanation 2

Q.28

If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then

A. the charge stored in it, increases.

B. the energy stored in it, decreases.

C. its capacitance increases.

D. the ratio of charge to its potential remains the same.

E. the product of charge and voltage increases.

Choose the most appropriate answer from the options given below:

(A)
A, B and E only
(B)
A, C and E only
(C)
B, D and E only
(D)
A, B and C only
(B)

Solution

Given Constant

Hence, final capacitance greater than initial capacitance,

Hence final energy is greater than initial energy

(iv) Product of charge and voltage

Q.29

A tightly wound 100 turns coil of radius carries a current of . The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as units):

(A)
44 mT
(B)
4.4 T
(C)
4.4 mT
(D)
44 T
(C)

Solution

The magnitude of magnetic field due to circular coil of N turns is given by

Q.30

A parallel plate capacitor is charged by connecting it to a battery through a resistor. If is the current in the circuit, then in the gap between the plates:

(A)
There is no current
(B)
Displacement current of magnitude equal to flows in the same direction as
(C)
Displacement current of magnitude equal to flows in a direction opposite to that of
(D)
Displacement current of magnitude greater than flows but can be in any direction
(B)

Solution

NEET 2024 Physics - Moving Charges and Magnetism Question 9 English Explanation

According to modified Ampere's law

For Loop and

For Loop and

Due to

Q.31

In a uniform magnetic field of , a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia of the needle is . If the magnitude of magnetic moment of the needle is , then the value of '' is :

NEET 2024 Physics - Magnetism and Matter Question 7 English

(A)
5
(B)
128
(C)
50
(D)
1280
(D)

Solution

Time period of Oscillation,

Q.32

NEET 2024 Physics - Magnetism and Matter Question 5 English

In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:

(A)
AB and DC
(B)
BA and CD
(C)
AB and CD
(D)
BA and DC
(A)

Solution

NEET 2024 Physics - Magnetism and Matter Question 5 English Explanation

North of magnet is moving away from solenoid 1 so end of solenoid 1 is South and as south of magnet is approaching solenoid 2 so end of solenoid 2 is South.

Q.33

Match List I with List II

List I
(Material)
List II
(Susceptibility ($$\chi))
A. Diamagnetic I.
B. Ferromagnetic II.
C. Paramagnetic III.
D. Non-magnetic IV. (a small positive number)

Choose the correct answer from the options given below.

(A)
A-II, B-III, C-IV, D-I
(B)
A-II, B-I, C-III, D-IV
(C)
A-III, B-II, C-I, D-IV
(D)
A-IV, B-III, C-II, D-I
(A)

Solution

(Material) (Susceptibility ($$\chi))
Diamagnetic (II)
Ferromagnetic (III)
Paramagnetic (IV)
Non-magnetic (I)

To match the magnetic materials with their respective magnetic susceptibilities, we must understand the characteristics of each type of material regarding its magnetic behavior. Here are the implications of each type:

Diamagnetic Materials: These materials are repelled by magnetic fields. The susceptibility () of diamagnetic materials is negative but very small, near zero. Therefore, and closer to zero, reflects this property.

Ferromagnetic Materials: They have a very high, positive susceptibility because these materials can be permanently magnetized. Their susceptibility () is much greater than one ().

Paramagnetic Materials: These materials are weakly attracted by a magnetic field, and their susceptibility is positive. However, the value of for paramagnetic materials is small but greater than zero (), where represents a small positive value.

Non-magnetic Materials: For materials that are considered non-magnetic, the susceptibility () is zero (), as they are neither attracted nor repelled by magnetic fields.

Let's match these descriptions with the given List II in your question:

  • Diamagnetic (A) matches with (II).
  • Ferromagnetic (B) corresponds to (III).
  • Paramagnetic (C) should be aligned with (IV).
  • Non-magnetic (D) clearly fits (I).

Therefore, the correct answer matches:

  • A-II, B-III, C-IV, D-I.

This aligns with Option A.

Q.34

A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:

A. hold the sheet there if it is magnetic.

B. hold the sheet there if it is non-magnetic.

C. move the sheet away from the pole with uniform velocity if it is conducting.

D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.

Choose the correct statement(s) from the options given below:

(A)
B and D only
(B)
A and C only
(C)
A, C and D only
(D)
C only
(B)

Solution

To understand which statement(s) is/are correct, we must explore the interactions between the magnetic field and different types of materials (magnetic, non-magnetic, conducting, non-conducting).

Statement A: If a sheet is magnetic and placed near a strong magnetic pole, it will experience a magnetic force due to the magnetic field. This force could either attract or repel the sheet depending on the polarity of the magnetic pole and the induced or inherent poles in the sheet. A force is needed to hold the sheet stationary against this magnetic force. Hence, statement A is true.

Statement B: If the sheet is non-magnetic, it will not experience any magnetic force because non-magnetic materials do not respond to magnetic fields in a manner where a force would be exerted on them. Thus, no external force is needed to hold a non-magnetic sheet in place near a magnetic pole. Statement B is false.

Statement C: If the sheet is conducting and you move it away from the magnetic pole, it will experience a change in the magnetic flux through it. According to Faraday's Law of Electromagnetic Induction, a change in magnetic flux induces an electromotive force (EMF) and consequently, currents known as eddy currents in the conductor. These induced currents produce their own magnetic fields, which interact with the original magnetic field, leading to a force (Lenz's Law). To move the sheet away with uniform velocity, a force must counteract this magnetic interaction. Therefore, statement C is true.

Statement D: If the sheet is non-conducting and non-polar, it will neither induce currents (since it's non-conducting) nor experience magnetic forces (since it's non-magnetic). Thus, moving such a sheet away from a magnetic pole with uniform velocity does not require overcoming any electromagnetic forces. Statement D is false.

Given these explanations, the correct statements are A and C only.

The correct choice is: Option B: A and C only.

Q.35

An iron bar of length has magnetic moment . It is bent at the middle of its length such that the two arms make an angle with each other. The magnetic moment of this new magnet is :

(A)
(B)
(C)
(D)
(B)

Solution

NEET 2024 Physics - Magnetism and Matter Question 6 English Explanation

Q.36

In an ideal transformer, the turns ratio is . The ratio is equal to (the symbols carry their usual meaning) :

(A)
(B)
(C)
(D)
(B)

Solution

An ideal transformer is a device that transfers electrical energy from one circuit to another through inductively coupled conductors—the transformer's coils. The primary coil (with turns) is connected to the input voltage (), and the secondary coil (with turns) delivers the output voltage ().

The relationship between the input (primary) voltage and output (secondary) voltage in a transformer is determined by the ratio of the number of turns in the primary coil to the number of turns in the secondary coil, expressed by the formula:

In this case, the given turns ratio is . To find the correct expression for , we need to invert the given ratio to reflect the relationship with respect to the voltages. This means:

Therefore, substituting into the voltage ratio equation:

This indicates that the secondary voltage () is twice the primary voltage (). If we were to express the ratio based on this, it would be:

Option B

This is the correct answer as it represents that, in accordance with the transformer's turns ratio, the voltage in the secondary coil is twice that in the primary coil.

Q.37

A capacitor is connected to a source as shown in figure. The peak current in the circuit is nearly :

NEET 2024 Physics - Alternating Current Question 8 English

(A)
0.58 A
(B)
0.93 A
(C)
1.20 A
(D)
0.35 A
(B)

Solution

Capacitive Reactance

Q.38

The property which is not of an electromagnetic wave travelling in free space is that:

(A)
They are transverse in nature
(B)
The energy density in electric field is equal to energy density in magnetic field
(C)
They travel with a speed equal to
(D)
They originate from charges moving with uniform speed
(D)

Solution

Electromagnetic waves have several defining characteristics when they propagate through free space. Let's evaluate each of the options provided:

Option A: They are transverse in nature.

This is true. Electromagnetic waves are transverse waves, meaning the directions of the electric field and magnetic field oscillations are perpendicular to the direction of wave propagation. The electric field (E) and magnetic field (B) vectors are also perpendicular to each other and to the direction of propagation.

Option B: The energy density in the electric field is equal to the energy density in the magnetic field.

This is also true. In electromagnetic waves, the energy density stored in the electric field is equal to the energy density stored in the magnetic field. This is because the magnitudes of the electric and magnetic fields are related by where c is the speed of light in vacuum. The energy density for each is given by for the electric field and for the magnetic field. Given the relationship between E and B in a wave, these two energy densities are equal.

Option C: They travel with a speed equal to .

This statement is true. The speed of electromagnetic waves in vacuum is given by , where is the magnetic permeability of free space and is the electric permittivity of free space. This relationship derives from Maxwell’s equations in a vacuum.

Option D: They originate from charges moving with uniform speed.

This statement is false. Electromagnetic waves are not generally produced by charges moving with a uniform speed; rather, they are produced by charges that are accelerating. Uniform motion (where velocity is constant and acceleration is zero) does not result in radiation of electromagnetic waves. If a charge is accelerating – changing either the speed or direction of its motion – it emits electromagnetic radiation.

Therefore, the correct answer is Option D, as it is the property that is not true for electromagnetic waves traveling in free space.

Q.39

A light ray enters through a right angled prism at point with the angle of incidence as shown in figure. It travels through the prism parallel to its base and emerges along the face . The refractive index of the prism is:

NEET 2024 Physics - Geometrical Optics Question 9 English

(A)
(B)
(C)
(D)
(B)

Solution

NEET 2024 Physics - Geometrical Optics Question 9 English Explanation

In prism,

Apply Snell's law, on incidence surface

On squaring

Q.40

A small telescope has an objective of focal length and an eye piece of focal length . The magnifying power of telescope for viewing a distant object is:

(A)
34
(B)
28
(C)
17
(D)
32
(B)

Solution

The magnifying power of a telescope when viewing distant objects can be calculated using the formula:

Given in the problem:

  • Focal Length of Objective Lens,
  • Focal Length of Eyepiece Lens,

Substituting these values into the formula gives:

Thus, the magnifying power of the telescope is 28. The correct answer is Option B.

Q.41

If the monochromatic source in Young's double slit experiment is replaced by white light, then

(A)
Interference pattern will disappear
(B)
There will be a central dark fringe surrounded by a few coloured fringes
(C)
There will be a central bright white fringe surrounded by a few coloured fringes
(D)
All bright fringes will be of equal width
(C)

Solution

In Young’s double-slit experiment, if a monochromatic source is replaced by white light, which contains multiple wavelengths, the patterns observed on the screen will differ significantly.

First, remember that the pattern formed in the double-slit experiment consists of both bright and dark fringes due to constructive and destructive interference, respectively. The position and intensity of these fringes depend on the wavelength of the light used. For monochromatic light (light of a single wavelength), the interference pattern is stable, with bright and dark fringes evenly spaced. Each fringe is uniformly bright or dark.

When using white light, which is a combination of various wavelengths of light, each color, or each wavelength, forms its own interference pattern with slightly different fringe spacing. This occurs because the separation between fringes is given by the formula:

Where:

  • is the wavelength of light
  • is the distance from the slits to the screen
  • is the separation between the slits

Since different wavelengths have different values for , each color’s fringes will be at slightly different positions. The result is that near the center of the pattern, where there is the least path difference, all wavelengths constructively interfere to form a bright white central fringe. However, moving away from the center, the fringes start to show different colors as the path difference between the light from the two slits increases. This causes a dispersion of colors with different orders of fringes dominated by different colors. The constructive and destructive interference patterns of different wavelengths slightly offset one another.

Thus:

  • Option A - "Interference pattern will disappear" is incorrect because the interference pattern does not disappear but changes due to the dispersion of colors.
  • Option B - "There will be a central dark fringe surrounded by a few coloured fringes" is incorrect as the central fringe in the presence of white light is bright, not dark.
  • Option C - "There will be a central bright white fringe surrounded by a few coloured fringes" is correct. This is because all the wavelengths interfere constructively at the center, creating a bright white fringe, succeeded by colored fringes due to the varying interference conditions for each wavelength.
  • Option D - "All bright fringes will be of equal width" is incorrect. The width and spacing of the fringes vary by wavelength, so the interference pattern will not have uniform fringe widths.

Therefore, the correct answer is Option C: "There will be a central bright white fringe surrounded by a few coloured fringes."

Q.42

An unpolarised light beam strikes a glass surface at Brewster's angle. Then

(A)
The reflected light will be partially polarised.
(B)
The refracted light will be completely polarised.
(C)
Both the reflected and refracted light will be completely polarised.
(D)
The reflected light will be completely polarised but the refracted light will be partially polarised.
(D)

Solution

NEET 2024 Physics - Wave Optics Question 8 English Explanation

According to Brewster's law, reflected rays are completely polarized and refracted rays are partially polarized.

Q.43

Given below are two statements:

Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.

Statement II: Atoms of each element are stable and emit their characteristic spectrum.

In the light of the above statements, choose the most appropriate answer from the options given below.

(A)
Both Statement I and Statement II are correct
(B)
Both Statement I and Statement II are incorrect
(C)
Statement I is correct but Statement II is incorrect
(D)
Statement I is incorrect but Statement II is correct
(C)

Solution

Let's analyze each statement one by one to determine the correctness:

Statement I: "Atoms are electrically neutral as they contain equal number of positive and negative charges."

This statement is correct. Atoms are composed of protons, neutrons, and electrons. Protons have a positive charge, electrons have a negative charge, and neutrons have no charge. In a neutral atom, the number of protons (positive charges) equals the number of electrons (negative charges), thus making the atom electrically neutral. The positive and negative charges balance each other, resulting in no overall charge.

Statement II: "Atoms of each element are stable and emit their characteristic spectrum."

This statement requires modification for accuracy. Atoms emit their characteristic spectrum when they are excited and then return to a lower energy state. The emission of a spectrum is not linked directly to the stability of an atom; it is linked to the electronic transitions within the atom. The term "stable" in relation to atoms typically refers to the overall energy state of an atom being at its lowest or in a ground state. However, atoms can emit radiation whether they are in a stable ground state or in an excited state. Moreover, not all atoms are inherently stable; some may be radioactive and unstable. The part that atoms emit their characteristic spectrum under certain conditions (like excitation) is correct, but linking this property strictly to stability is misleading.

Based on the analysis:

  • Statement I is correct.
  • Statement II is partially correct, as it is accurate that each element can emit a characteristic spectrum when excited, but incorrect in generalizing that all such atoms are stable.

Therefore, the correct option is:

Option C: Statement I is correct but Statement II is incorrect.

Q.44

Match List I with List II:

List I
(Spectral Lines of Hydrogen for transitions from)
List II
(Wavelengths (nm))
A. I. 410.2
B. II. 434.1
C. III. 656.3
D. IV. 486.1

Choose the correct answer from the options given below:

(A)
A-II, B-I, C-IV, D-III
(B)
A-III, B-IV, C-II, D-I
(C)
A-IV, B-III, C-I, D-II
(D)
A-I, B-II, C-III, D-IV
(B)

Solution

A-III, B-IV, C-II, D-I

Q.45

In the nuclear emission stated above, the mass number and atomic number of the product respectively, are

(A)
280, 81
(B)
286, 80
(C)
288, 82
(D)
286, 81
(D)

Solution

To determine the mass number and atomic number of the final product in the provided nuclear reactions, we need to analyze the impact of each type of decay (alpha, positron emission, beta-minus decay, and electron capture) on the mass number and atomic number of the initial element :

1. Alpha decay ( decay): In alpha decay, an alpha particle (which is a nucleus) is emitted. This reduces the mass number by 4 units and the atomic number by 2 units.

2. Beta plus decay (positron emission, ): During positron emission, a proton in the nucleus is transformed into a neutron, and a positron is emitted. This decreases the atomic number by 1 but does not change the mass number.

3. Beta-minus decay ( decay): In a beta-minus decay, a neutron in the nucleus converts into a proton and an electron (beta particle) and an antineutrino are emitted. This results in an increase in the atomic number by 1, while the mass number remains unchanged.

4. Electron capture ( capture): During electron capture, an atomic electron is absorbed by the nucleus, causing a proton to convert into a neutron. This process decreases the atomic number by 1 without altering the mass number.

From the calculations above, the mass number of is 286, and its atomic number is 79. Comparing these values with the multiple choices:

Option A: Mass number = 280, Atomic number = 81
Option B: Mass number = 286, Atomic number = 80
Option C: Mass number = 288, Atomic number = 82
Option D: Mass number = 286, Atomic number = 81

None of these match exactly, implying an error in the problem or the answer options. Based on the correct atomic number calculations and assuming option D is meant to be atomic number 79, then the corrected choice would have been:

D: Mass number = 286, Atomic number = 79

Q.46

The graph which shows the variation of and its kinetic energy, is (where is de Broglie wavelength of a free particle):

(A)
NEET 2024 Physics - Dual Nature of Radiation and Matter Question 11 English Option 1
(B)
NEET 2024 Physics - Dual Nature of Radiation and Matter Question 11 English Option 2
(C)
NEET 2024 Physics - Dual Nature of Radiation and Matter Question 11 English Option 3
(D)
NEET 2024 Physics - Dual Nature of Radiation and Matter Question 11 English Option 4
(D)

Solution

de-Broglie wavelength where

Squaring both sides,

Graph passes through origin with constant slope.

Q.47

If is the velocity of light in free space, the correct statements about photon among the following are:

A. The energy of a photon is .

B. The velocity of a photon is .

C. The momentum of a photon, .

D. In a photon-electron collision, both total energy and total momentum are conserved.

E. Photon possesses positive charge.

Choose the correct answer from the options given below:

(A)
A and B only
(B)
A, B, C and D only
(C)
A, C and D only
(D)
A, B, D and E only
(B)

Solution

A. The energy of a photon is .

This statement is correct. The energy of a photon is given by the equation:

where is the energy, is Planck's constant, and (also written as ) is the frequency of the photon.

B. The velocity of a photon is .

This statement is also correct. In free space (vacuum), the velocity of light, and hence the velocity of a photon, is constant and is denoted by .

C. The momentum of a photon, .

This statement is correct as well. The momentum of a photon can be expressed as:

D. In a photon-electron collision, both total energy and total momentum are conserved.

This statement is correct. During collisions involving photons and electrons, such as Compton scattering, both energy and momentum are conserved.

E. Photon possesses positive charge.

This statement is incorrect. Photons are electrically neutral particles and do not possess any charge.

Based on the analysis, the correct statements are A, B, C, and D. Therefore, the correct answer is:

Option B
A, B, C, and D only

Q.48

A logic circuit provides the output as per the following truth table :

NEET 2024 Physics - Semiconductor Electronics Question 12 English

The expression of the output Y is :

(A)
(B)
(C)
(D)
B
(C)

Solution

NEET 2024 Physics - Semiconductor Electronics Question 12 English Explanation

According to given truth table, output is independent on value of

Output

Q.49

Consider the following statements A and B and identify the correct answer :

NEET 2024 Physics - Semiconductor Electronics Question 11 English

A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.

B. In a reverse biased junction diode, the current measured in , is due to majority charge carriers.

(A)
is correct but is incorrect
(B)
is incorrect but is correct
(C)
Both A and B are correct
(D)
Both and are incorrect
(A)

Solution

A : Solar cell characteristics

NEET 2024 Physics - Semiconductor Electronics Question 11 English Explanation

B : In reverse biased junction diode, the current measured in , is due to minority charge carrier.

Q.50

NEET 2024 Physics - Semiconductor Electronics Question 13 English

(A)
NAND gate
(B)
NOR gate
(C)
OR gate
(D)
AND gate
(D)

Solution

NEET 2024 Physics - Semiconductor Electronics Question 13 English Explanation

= A.B is similar to output of AND gate.

Chemistry (Maximum Marks: 200)
  • This section contains 50 questions.
  • Each question has FOUR options (A), (B), (C) and (D). ONLY ONE of these four options is the correct answer.
  • Full Marks : +4 If ONLY the correct option is chosen;
  • Zero Marks : 0 If none of the options is chosen (i.e. the question is unanswered);
  • Negative Marks : −1 In all other cases.
Q.1

1 gram of sodium hydroxide was treated with of solution, the mass of sodium hydroxide left unreacted is equal to

(A)
750 mg
(B)
250 mg
(C)
Zero mg
(D)
200 mg
(B)

Solution

To find the mass of sodium hydroxide (NaOH) left unreacted, we first need to determine the moles of NaOH and HCl originally present and compare them to see which one is in excess.

The molar mass of NaOH is approximately , so the number of moles of NaOH in 1 gram can be calculated as follows:

Next, we calculate the number of moles of HCl using its concentration and the volume of the solution. Recall that concentration (Molarity, M) is defined as moles of solute per liter of solution. Given that the concentration of HCl is and the volume of the solution is or , we can find the moles of HCl:

Now, we compare the moles of NaOH and HCl. The stoichiometry of the reaction between NaOH and HCl is:

Each mole of NaOH reacts with one mole of HCl. Given that there are more moles of NaOH (0.025 moles) than HCl (0.01875 moles), HCl is the limiting reactant and will be completely consumed. The excess NaOH can be calculated:

To find the mass of the unreacted NaOH:

Therefore, the mass of sodium hydroxide left unreacted is 250 mg, which corresponds to Option B.

Q.2

The highest number of helium atoms is in

(A)
of helium
(B)
of helium
(C)
of helium
(D)
of helium at STP
(A)

Solution

To determine which option contains the highest number of helium atoms, we need to analyze each option based on the amount of helium it represents and apply Avogadro's Law as required.

Option A: of helium

Using Avogadro's number, which is approximately atoms per mole, the number of helium atoms in 4 moles can be calculated as:

Option B: of helium

The atomic mass of helium is approximately 4 u (atomic mass units). Therefore, represents about 1 mole of helium atoms (since the molar mass of helium is approximately 4 g/mol, which equals 4 u). Thus, this option represents:

Option C: of helium

Similarly, as we've established that the molar mass of helium is 4 g/mol, of helium equates exactly to:

Option D: of helium at STP (Standard Temperature and Pressure)

At STP, one mole of any ideal gas occupies 22.4 L. Therefore, the amount of helium in moles for can be derived from:

Using this to find the number of atoms:

Conclusion:

Comparing the numbers:

  • Option A:

  • Option B:

  • Option C:

  • Option D:

Option A clearly contains the highest number of helium atoms, which is

Q.3

A compound X contains of A, of B and remaining percentage of C. Then, the empirical formula of is :

(Given atomic masses of A=64 ; B=40 ; C=32 u)

(A)
(B)
(C)
(D)
(B)

Solution

Element Mass percentage % No. of moles No. of moles/Smallest number Simplest whole number
A 32% = 1
B 20% = 1
C 48% = 3

So, empirical formula of NEET 2024 Chemistry - Some Basic Concepts of Chemistry Question 10 English Explanation

Q.4

The energy of an electron in the ground state for ion is , then that for an electron in state for ion in is

(A)
(B)
(C)
(D)
(A)

Solution

The energy levels of an electron in a hydrogen-like ion (an atom or ion with only one electron) can be quantified using the formula:

where:

  • is the energy of the electron in the nth energy level,

  • is the atomic number (number of protons) of the ion,

  • is the ionization energy of hydrogen,

  • is the principal quantum number (the energy level).

Since we need to compare this across different ions in different energy states, let's plug in some numbers:

For (Helium ion):

  • (as helium has 2 protons)

  • for ground state

However, the problem gives the energy in joules, and it's given a constant . So, (converted to joules as needed).

Next, for the ion:

  • (as beryllium has 4 protons)

Since initially (or its equivalent in joules) for , and now we have the same energy for , the energy level in joules would also equate to , just at a different energy state and ion.

So, the answer is:

Option A: .

Q.5

Match List I with List II.

List I
(Quantum Number)
List II
(Information provided)
A. I. Shape of orbital
B. II. Size of orbital
C. I III. Orientation of orbital
D. n IV. Orientation of spin of electron

Choose the correct answer from the options given below :

(A)
A-I, B-III, C-II, D-IV
(B)
A-III, B-IV, C-I, D-II
(C)
A-III, B-IV, C-II, D-I
(D)
A-II, B-I, C-IV, D-III
(B)

Solution

To match List I (Quantum Numbers) with List II (Information provided), we need to understand what each quantum number represents:

1. Principal Quantum Number (): This quantum number determines the size and energy level of the orbital. An increase in implies a higher energy level and a larger orbital size.

2. Azimuthal Quantum Number (): (not directly listed but related to because depends on ): This quantum number defines the shape of the orbital. Different values of correspond to different shapes (s, p, d, f, etc.).

3. Magnetic Quantum Number (): This quantum number describes the orientation of the orbital in space. It can take values from to , where each value corresponds to a specific orientation of the orbital.

4. Spin Quantum Number (): This quantum number specifies the orientation of the spin of the electron. The two possible values are and , representing the two possible spin orientations (up or down).

Matching the given options:

A. - should be matched with "Orientation of orbital" (III).

B. - should be matched with "Orientation of spin of electron" (IV).

C. I - This is likely intended to be , and would be matched with "Shape of orbital" (I).

D. - relates to "Size of orbital" (II), as it affects the distance from the nucleus along with the energy level.

Using the understanding above, we can identify the correct matches:

A-III (Orientation of orbital)

B-IV (Orientation of spin of electron)

C-I (Shape of orbital)

D-II (Size of orbital)

Therefore, the correct answer is:

Option B: A-III, B-IV, C-I, D-II

Q.6

Which reaction is NOT a redox reaction?

(A)
(B)
(C)
(D)
(D)

Solution

NEET 2024 Chemistry - Redox Reactions Question 5 English Explanation

This is not a redox reaction as there is no change in oxidation state.

Q.7

In which of the following equilibria, and are NOT equal?

(A)
(B)
(C)
(D)
(A)

Solution

To determine in which of the given equilibria and are not equal, it's important to understand the relationship between these two equilibrium constants. This relationship is expressed by the equation:

where is the gas constant, is the temperature in Kelvin, and is the change in the number of moles of gas (number of moles of gaseous products minus number of moles of gaseous reactants).

If , then and are equal because . However, if , the constants will not be the same, and the degree to which they differ will depend on the temperature and the value of .

Now, let's analyze each option:

  • Option A:

Reactant side moles = 1, Product side moles = 2; .

  • Option B:

Reactant side moles = 2, Product side moles = 2; .

  • Option C:

Reactant side moles = 2, Product side moles = 2; .

  • Option D:

Reactant side moles = 2, Product side moles = 2; .

From this analysis, it is evident that and are not equal in Option A where . In all other options, since , is equal to . Thus, the correct answer is Option A.

Q.8

For the reaction . At a given time, the composition of reaction mixture is: Then, which of the following is correct?

(A)
Reaction is at equilibrium.
(B)
Reaction has a tendency to go in forward direction.
(C)
Reaction has a tendency to go in backward direction.
(D)
Reaction has gone to completion in forward direction.
(C)

Solution

To determine which option is correct regarding the reaction state and its direction, we need to calculate the reaction quotient and compare it to the equilibrium constant . The reaction given is:

The equilibrium constant expression for this reaction is:

Given that and the concentrations of A, B, and C at this time are each M, we can substitute these values into the expression for to calculate the reaction quotient :

Simplifying, we find:

Comparing with :

Since (1 > 0.004), the reaction quotient is greater than the equilibrium constant. This indicates that the concentration of products (B and C) is too high relative to the concentration of reactants (A) for the system to be at equilibrium under these conditions.

This means that the reaction has a tendency to move in the backward direction to reach equilibrium, reducing the concentration of the products (B and C) and increasing the concentration of the reactant (A). Therefore, the correct answer to the given question is:

Option C: Reaction has a tendency to go in backward direction.

Q.9

Consider the following reaction in a sealed vessel at equilibrium with concentrations of and .

If of is taken in a closed vessel, what will be degree of dissociation () of at equilibrium?

(A)
0.00889
(B)
0.0889
(C)
0.8889
(D)
0.717
(D)

Solution

NEET 2024 Chemistry - Chemical Equilibrium Question 6 English Explanation

Q.10

The Henry's law constant values of three gases in water are and respectively. The solubility of these gases in water follow the order:

(A)
B > A > C
(B)
B > C > A
(C)
A > C > B
(D)
A > B > C
(B)

Solution

According to Henry's law, the solubility of a gas in a liquid under constant temperature is directly proportional to the partial pressure of the gas above the liquid but is inversely proportional to the Henry's law constant for the gas. Henry's law can be expressed as:

where is the concentration (or solubility) of the gas in the liquid, is the partial pressure of the gas, and is Henry's law constant.

From the equation, it is clear that the solubility of the gas is inversely related to ; if increases, the solubility decreases, and vice versa.

In the given problem, you have the values of the gases A, B, and C as follows:

  • A: 145 kbar
  • B:
  • C: 35 kbar

Comparing the values:

  • Gas B has the lowest and hence the highest solubility.
  • Gas A, with the highest among the three, will have the lowest solubility.
  • Gas C has a value less than A but greater than B, so its solubility will be lower than B but higher than A.

Therefore, the order of solubility of the gases in water from the highest to the lowest is:

B > C > A

Thus, the correct option is:

Option B: B > C > A

Q.11

The plot of osmotic pressure (П) vs concentration for a solution gives a straight line with slope . The temperature at which the osmotic pressure measurement is done is

(Use )

(A)
(B)
(C)
(D)
(A)

Solution

The relationship between the osmotic pressure of a solution and its concentration can be derived from the van't Hoff equation for dilute solutions, which is given by:

where:

  • is the osmotic pressure,
  • is the concentration of the solution in moles per liter,
  • is the ideal gas constant in appropriate units, and
  • is the temperature in Kelvin.

According to the problem, the slope of the vs plot is given as which corresponds to the product from the van't Hoff equation. We are provided with the value of the gas constant .

To find the temperature , we use the following equation derived from the slope of the line:

To isolate , we rearrange the equation:

To convert this temperature from Kelvin to Celsius, we use the conversion formula:

This value is closest to , which corresponds to Option A. Therefore, the temperature at which the osmotic pressure measurement is done is approximately .

Q.12

In which of the following processes entropy increases?

A. A liquid evaporates to vapour.

B. Temperature of a crystalline solid lowered from to .

C.

D.

Choose the correct answer from the options given below:

(A)
A and C
(B)
A, B and D
(C)
A, C and D
(D)
C and D
(C)

Solution

The concept of entropy in thermodynamics refers to the degree of randomness or disorder in a system. An increase in entropy is generally associated with processes in which disorder increases. Let's analyze each option listed:

A. A liquid evaporates to vapour.

During the evaporation of a liquid to form a vapour, the molecules of the substance move from a relatively ordered state (liquid) to a more disordered state (vapour). In a vapour, the molecules have more freedom of motion and are less confined than in a liquid. This transition from liquid to vapour increases the randomness or disorder of the system, hence, the entropy increases.

B. Temperature of a crystalline solid lowered from to .

Reducing the temperature of a crystalline solid generally decreases the entropy of the system. As the temperature decreases, the molecular motion within the solid becomes more restricted, leading to a decrease in randomness. At absolute zero (), the entropy is at its lowest possible value (ideally zero for a perfect crystal), as the molecular motion is minimized to only quantum mechanical vibrations.

C.

In this chemical reaction, solid sodium bicarbonate decomposes to form solid sodium carbonate, carbon dioxide gas, and water vapor. The formation of gases from a solid significantly increases the entropy of the system because gases have much higher randomness due to their free molecular motion compared to solids.

D.

The dissociation of chlorine gas () into atomic chlorine () represents a transition from a diatomic molecule to two separate atoms. This increases the number of particles in the gas phase, leading to increased randomness and disorder, hence, increasing the entropy.

Conclusion: Based on our analysis, processes A, C, and D involve an increase in entropy, as they each lead to greater disorder or randomness in the system. Option B is incorrect as it wrongly includes lowering the temperature of a solid as increasing entropy. Therefore, the correct answer is:

Option C :

A, C and D

Q.13

Match List I with List II.

List I
(Process)
List II
(Conditions)
A. Isothermal process I. No heat exchange
B. Isochoric process II. Carried out at constant temperature
C. Isobaric process III. Carried out at constant volume
D. Adiabatic process IV. Carried out at constant pressure

Choose the correct answer from the options given below:

(A)
A-IV, B-III, C-II, D-I
(B)
A-IV, B-II, C-III, D-I
(C)
A-I, B-II, C-III, D-IV
(D)
A-II, B-III, C-IV, D-I
(D)

Solution

The question involves matching different thermodynamic processes with their corresponding description or characteristics. Let's analyze these processes:

  • Isothermal process (A): This process occurs at a constant temperature. Hence, A should match with "Carried out at constant temperature" (II).
  • Isochoric process (B): This process occurs at a constant volume. Therefore, B should be matched with "Carried out at constant volume" (III).
  • Isobaric process (C): This process happens at a constant pressure, making C correspond to "Carried out at constant pressure" (IV).
  • Adiabatic process (D): During this process, there is no heat exchange with the surroundings. Consequently, D should be paired with "No heat exchange" (I).

Reviewing the options:

  • Option A: A-IV, B-III, C-II, D-I
  • Option B: A-IV, B-II, C-III, D-I
  • Option C: A-I, B-II, C-III, D-IV
  • Option D: A-II, B-III, C-IV, D-I

The correct matches, as elaborated above, are A-II, B-III, C-IV, D-I. Therefore, the correct answer here is Option D.

Q.14

The work done during reversible isothermal expansion of one mole of hydrogen gas at from pressure of 20 atmosphere to 10 atmosphere is (Given )

(A)
0 calorie
(B)
413.14 calories
(C)
413.14 calories
(D)
100 calories
(B)

Solution

The work done in a reversible isothermal process can be calculated using the formula:

Here:

  • is the work done by the gas.
  • is the number of moles of the gas.
  • is the universal gas constant.
  • is the temperature in Kelvin.
  • and are the initial and final volumes of the gas, respectively.

However, since the volumes are not directly provided but the pressures are given, we use the ideal gas law, , to relate pressures and volumes at the same temperature and amount of gas:

For an ideal gas undergoing a change at constant temperature, we can also write the work done in terms of the initial and final pressures:

where:

  • and are the initial and final pressures, respectively.

Given:

  • (one mole of hydrogen)

Substituting all values into the formula:

Now, solving this using the value of :

Thus, the work done during the process is about , indicating that this amount of energy was done by the system (expansion work being done by the gas against external pressure), and hence is negative as it indicates work done by the system. Therefore, the correct option is:

Option B:

Q.15

Match List I with List II.

List I
(Conversion)
List II
(Number of Faraday required)
A. 1 mole of HO to O I. 3F
B. 1 mol of MnO to Mn II. 2F
C. 1.5 mol of Ca from molten CaCl III. 1F
D. 1 mol of FeO to FeO IV. 5F

Choose the correct answer from the options given below :

(A)
A-II, B-IV, C-I, D-III
(B)
A-III, B-IV, C-I, D-II
(C)
A-II, B-III, C-I, D-IV
(D)
A-III, B-IV, C-II, D-I
(A)

Solution

To answer this question, we need to calculate the number of Faraday's required for each of the reactions in List I.

Reaction A: Conversion of H2O to O2

The reaction for electrolysis of water to produce oxygen can be written as:

Each mole of O2 requires the transfer of 4 moles of electrons. Therefore, to produce 1 mole of O2, you need 4 Faraday's of charge. However, since the reaction shown in the table suggests the production of only 1 mole, it would require 2 Faraday's. This is because we are dealing with a half reaction in which only 2 moles of electrons are required for every mole of O2 produced from 1 mole of H2O.

Reaction B: Conversion of MnO4- to Mn2+

The reduction reaction for permanganate to manganese ion is:

This reaction indicates that 5 moles of electrons are involved in the reduction of 1 mole of MnO4- to Mn2+. Therefore, 5 Faraday's are required.

Reaction C: Production of 1.5 moles of Ca from molten CaCl2

The electrolytic production of calcium from its chloride can be illustrated as follows:

Each mole of Ca produced requires 2 Faraday's of electrons considering the transfer of 2 moles of electrons. For 1.5 moles of Ca, the total Faraday's required would be 3 Faraday's, because, 1.5 * 2 = 3F.

Reaction D: Oxidation of FeO to Fe2O3

The reaction can be considered in terms of iron oxidation states:

Each mole of O2 requires 2 Faraday's of charge. If the products include 2 moles of Fe2O3 and 1 mole of O2, thus, only 2 Faraday's will be required for 1 mole of FeO to react (considering FeO as just a part of the full reaction).

Correct Matching:

A-II, B-IV, C-I, D-III

The mappings are A-II (2F for H2O to O2), B-IV (5F for MnO4- to Mn2+), C-I (3F for 1.5 mol of Ca from CaCl2), and D-III (2F for FeO to Fe2O3).

Therefore, the correct answer is Option A:

A-II, B-IV, C-I, D-III.

Q.16

Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is (Given : Molar mass of )

(A)
3.15 g
(B)
0.315 g
(C)
31.5 g
(D)
0.0315 g
(B)

Solution

The mass of copper deposited when passing an electric current through a copper sulphate solution can be calculated using Faraday's laws of electrolysis. The first law states that the amount of a substance deposited or liberated at an electrode during electrolysis is proportional to the amount of electricity (charge) passed through the electrolyte.

To find the mass of copper deposited, we use the formula:

Where:

  • is the mass of the substance deposited (in grams),

  • is the molar mass of the substance (in g/mol),

  • is the current (in amperes, A),

  • is the time electricity is passed through the solution (in seconds),

  • is the number of moles of electrons required to deposit or dissolve 1 mole of the substance (valence number, which is 2 for copper in copper sulphate solution as copper ions are ),

  • is the Faraday constant, approximately of electrons.

Given:





Substitute these values into the formula:

Calculate the value of :

Hence, the mass of copper deposited is approximately 0.315 g, making Option B the correct answer.

Q.17

Activation energy of any chemical reaction can be calculated if one knows the value of

(A)
rate constant at standard temperature
(B)
probability of collision
(C)
orientation of reactant molecules during collision
(D)
rate constant at two different temperatures
(D)

Solution

To calculate value of

Equation used is

Hence can be calculated if value of rate constant k is known at two different temperatures and .

Q.18

Which plot of vs is consistent with Arrhenius equation?

(A)
NEET 2024 Chemistry - Chemical Kinetics Question 11 English Option 1
(B)
NEET 2024 Chemistry - Chemical Kinetics Question 11 English Option 2
(C)
NEET 2024 Chemistry - Chemical Kinetics Question 11 English Option 3
(D)
NEET 2024 Chemistry - Chemical Kinetics Question 11 English Option 4
(D)

Solution

The Arrhenius equation is given as

NEET 2024 Chemistry - Chemical Kinetics Question 11 English Explanation

Q.19

The rate of a reaction quadruples when temperature changes from to . Calculate the energy of activation.

Given

(A)
(B)
(C)
(D)
(A)

Solution

To solve this problem, we will use the Arrhenius equation, which relates the rate constant () of a chemical reaction to the temperature () and the activation energy (). The equation in its logarithmic form is:

where:

  • is the rate constant,
  • is the pre-exponential factor (frequency factor),
  • is the activation energy,
  • is the universal gas constant (),
  • is the temperature in Kelvin,
  • is the factor to convert from natural log to common log.

According to the problem, the rate of the reaction quadruples () when the temperature increases from (which equals ) to (which equals ). Using the logarithmic form of the Arrhenius equation, for two different temperatures we have:




With , substituting in the values and taking their difference:



Given that , we now solve for :


First, calculate :



So,



Solve for :

Therefore, the activation energy is , which best matches Option A:

Q.20

Arrange the following elements in increasing order of first ionization enthalpy:

Choose the correct answer from the options given below:

(A)
(B)
(C)
(D)
(B)

Solution

The first ionization enthalpy, also known as ionization energy, is the energy required to remove the most loosely bound electron from a neutral atom in the gaseous phase to form a cation. The trend of first ionization energies generally increases across a period from left to right in the periodic table. This is due to the increasing nuclear charge and the decreasing atomic radius, which cause the valence electrons to be attracted more strongly to the nucleus.

However, there are notable exceptions based on the electron configuration stability and electron pairing in orbitals. Let's analyze the given elements:

  • Lithium (Li): Being the first element in the period, it has the smallest nuclear charge and only one electron in its outer shell, which makes it easy to remove an electron.
  • Beryllium (Be): This element has two electrons in the 2s orbital. The removal of one electron slightly disturbs the fully filled 2s sub-shell, creating more stability than having an unpaired electron. Therefore, Be has a higher ionization energy than Li.
  • Boron (B): This element has a half-filled 2p orbital configuration (one electron in the 2p orbital), which is relatively less stable compared to a full or empty p orbital, leading to a slightly lower ionization energy than Be.
  • Carbon (C): With two electrons in separate 2p orbitals (following Hund's rule), C experiences more effective nuclear shielding and electron-electron repulsion compared to a single electron in Boron's 2p orbital. This makes it relatively easier to remove an electron from B than from C, but harder than removing one from Be.
  • Nitrogen (N): It has exactly half-filled 2p orbitals, which provides extra stability and hence has a higher ionization energy than Carbon. Contrarily, the configuration of three p electrons is stable owing to the exchange energy and symmetric distribution in space.

Given these points, we can order the elements by increasing first ionization enthalpy as follows:

This matches with Option B. Thus, the correct answer is:

Option B

Element First ionization enthalpy
Li 520
Be 899
B 801
C 1086
N 1402

Q.21

Arrange the following elements in increasing order of electronegativity:

N, O, F, C, Si

Choose the correct answer from the options given below :

(A)
Si < C < N < O < F
(B)
Si < C < O < N < F
(C)
O < F < N < C < Si
(D)
F < O < N < C < Si
(A)

Solution

Electronegativity is a chemical property that describes the tendency of an atom to attract a shared pair of electrons (or electron density) towards itself in a chemical bond. The Pauling scale is the most commonly used scale to measure electronegativity. According to this scale:

  • The electronegativity of Fluorine (F) is the highest among the elements at around 3.98.
  • Oxygen (O) follows next with an electronegativity of about 3.44.
  • Nitrogen (N) has an electronegativity of approximately 3.04.
  • Carbon (C) has an electronegativity value close to 2.55.
  • Silicon (Si), being further down the group in the periodic table than Carbon, has a lower electronegativity of about 1.90.

Based on these values, we can arrange the elements in order of increasing electronegativity as follows:

Thus, considering the options provided:

Option A: Si < C < N < O < F is the correct answer since it correctly ranks the elements from the lowest to the highest electronegativity.

Q.22

Match List I with List II.

List I
(Molecule)
List II
(Number and types of bond/s between two carbon atoms)
A. ethane I. one -bond and two -bonds
B. ethene II. two -bonds
C. carbon molecule, C III. one -bond
D. ethyne IV. one -bond and one -bond

Choose the correct answer from the options given below :

(A)
A-I, B-IV, C-II, D-III
(B)
A-IV, B-III, C-II, D-I
(C)
A-III, B-IV, C-II, D-I
(D)
A-III, B-IV, C-I, D-II
(C)

Solution

(A) Ethane NEET 2024 Chemistry - Chemical Bonding and Molecular Structure Question 13 English Explanation 1 one ( bond
(B) Ethene NEET 2024 Chemistry - Chemical Bonding and Molecular Structure Question 13 English Explanation 2
(C) C two bonds
(D) Ethyne

Q.23

Given below are two statements:

Statement I: The boiling point of hydrides of Group 16 elements follow the order

Statement II: On the basis of molecular mass, is expected to have lower boiling point than the other members of the group but due to the presence of extensive -bonding in , it has higher boiling point.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are true
(B)
Both Statement I and Statement II are false
(C)
Statement I is true but Statement II is false
(D)
Statement I is false but Statement II is true
(A)

Solution

The given question involves understanding the boiling points of Group 16 hydrides and the effect of molecular mass and hydrogen bonding on these boiling points.

Statement I claims that the boiling points of Group 16 hydrides follow this order:

This statement is indeed true. Water () has a much higher boiling point compared to the other hydrides in Group 16. This anomaly primarily arises due to the extensive hydrogen bonding present in water, which greatly increases its boiling point. In the absence of such strong hydrogen bonding, heavier molecules like , , and would typically have higher boiling points due to increased van der Waals forces (attributable to larger molecular mass and size). But in this case, surpasses them because hydrogen bonds are much stronger than van der Waals forces.

Statement II states that based on molecular mass alone, should have a lower boiling point than the other Group 16 hydrides but has a higher boiling point due to extensive hydrogen bonding. This statement is also true. Water, having a lower molecular mass, would typically have a lower boiling point if we consider only molecular mass. However, the strong hydrogen bonds between water molecules contribute to a much higher boiling point. Hydrogen bonding significantly impacts physical properties like boiling point because it requires more energy to break these bonds during the phase change from liquid to gas.

In summary, based on the analysis of the two statements:

Option A: Both Statement I and Statement II are true is the correct answer. Each statement is correct, and both relate accurately to the anomalous behavior of water among the hydrides of Group 16 elements.

Q.24

Intramolecular hydrogen bonding is present in

(A)
NEET 2024 Chemistry - Chemical Bonding and Molecular Structure Question 14 English Option 1
(B)
NEET 2024 Chemistry - Chemical Bonding and Molecular Structure Question 14 English Option 2
(C)
NEET 2024 Chemistry - Chemical Bonding and Molecular Structure Question 14 English Option 3
(D)
HF
(A)

Solution

In o-nitrophenol intramolecular H-bonding is present.

NEET 2024 Chemistry - Chemical Bonding and Molecular Structure Question 14 English Explanation

Q.25

Match List I with List II.

List I
(Compound)
List II
(Shape/geometry)
A. NH I. Trigonal Pyramidal
B. BrF II. Square Planar
C. XeF III. Octahedral
D. SF IV. Square Pyramidal

Choose the correct answer from the options given below:

(A)
A-I, B-IV, C-II, D-III
(B)
A-II, B-IV, C-III, D-I
(C)
A-III, B-IV, C-I, D-II
(D)
A-II, B-III, C-IV, D-I
(A)

Solution

hybridised with 1 lone pair.

Structure will be Trigonal Pyramidal.

hybridised with 1 lone pair.

Structure will be Square Pyramidal.

with two lone pairs.

Structure will be Square Planar.

with no lone pair.

Structure will be Octahedral.

A-I, B-IV, C-II, D-III

Q.26

Identify the correct answer.

(A)
Three resonance structures can be drawn for ozone
(B)
has non-zero dipole moment
(C)
Dipole moment of is greater than that of
(D)
Three canonical forms can be drawn for ion
(D)

Solution

(1) In ozone; there are two resonating structures.

NEET 2024 Chemistry - Chemical Bonding and Molecular Structure Question 15 English Explanation

Q.27

Among Group 16 elements, which one does NOT show -2 oxidation state?

(A)
O
(B)
(C)
(D)
Po
(D)

Solution

The elements in Group 16 of the periodic table, also known as the chalcogens, include oxygen (O), sulfur (S), selenium (Se), tellurium (Te), and polonium (Po). Generally, these elements are known to commonly exhibit a -2 oxidation state because they have six electrons in their outermost shell and can gain two electrons to complete their octet, thereby achieving a stable electronic configuration similar to the nearest noble gas.

Oxygen, being the most electronegative element in this group, predominantly shows a -2 oxidation state in most of its compounds, such as water () and oxides like .

Selenium and Tellurium also typically exhibit the -2 oxidation state. For instance, in compounds like (hydrogen selenide) and (hydrogen telluride), these elements are in the -2 state.

Polonium (Po), on the other hand, is different from the lighter chalcogens. Being a metalloid with more metallic character, it does not favor the -2 oxidation state nearly as strongly as the other elements in its group. Polonium most commonly exhibits +2 and +4 oxidation states in its compounds, like and . Due to the relativistic effects and its position in the periodic table, the -2 oxidation state is unstable and rare in polonium compounds.

Given this, the correct answer is Option D: Po. Polonium does not commonly exhibit the -2 oxidation state like the other Group 16 elements.

Q.28

Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to .

A.

B.

C.

D.

E.

Choose the correct answer from the options given below.

(A)
B, A, D, C, E
(B)
B, C, A, D, E
(C)
E, C, D, B, A
(D)
E, A, B, C, D
(A)

Solution

Group Cations
Group-II Cu
Group-III Al
Group-IV Co
Group-V Ba
Group-VI Mg

The correct order of group number of ions is

The correct order is B, A, D, C, E

Q.29

'Spin only' magnetic moment is same for which of the following ions?

A.

B.

C.

D.

E.

Choose the most appropriate answer from the options given below.

(A)
B and D only
(B)
A and E only
(C)
B and C only
(D)
A and D only
(A)

Solution

Ions No. of unpaired electrons Configuration
Ti 1 3d
4
5
4
0

Spin only magnetic moment is given by

and will have same spin only magnetic moment.

Q.30

The value for the couple is more positive than that of or due to change of

(A)
to configuration
(B)
to configuration
(C)
to configuration
(D)
to configuration
(C)

Solution

Electronic configuration of

Electronic configuration of

Electronic configuration of

Electronic configuration of

As from configuration goes to more stable configuration (Half filled), due to more exchange energy in configuration.

Q.31

The pair of lanthanoid ions which are diamagnetic is

(A)
and
(B)
and
(C)
and
(D)
and
(A)

Solution

Magnetic moment

number of unpaired electron

NEET 2024 Chemistry - d and f Block Elements Question 15 English Explanation

Hence and are only diamagnetic.

Q.32

Match List I with List II.

List I
(Complex)
List II
(Type of isomerism)
A. I. Solvate isomerism
B. II. Linkage isomerism
C. III. Ionization isomerism
D. IV. Coordination isomerism

Choose the correct answer from the options given below:

(A)
A-II, B-III, C-IV, D-I
(B)
A-I, B-III, C-IV, D-II
(C)
A-I, B-IV, C-III, D-II
(D)
A-II, B-IV, C-III, D-I
(A)

Solution

A. I. Linkage isomerism due to 'N' and 'O' linkage by NO
B. II. Ionization isomerism
C. III. Coordination isomerism
D. IV. Solvate isomerism

Q.33

Given below are two statements :

Statement I: Both and complexes are octahedral but differ in their magnetic behaviour.

Statement II: is diamagnetic whereas is paramagnetic.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are true
(B)
Both Statement I and Statement II are false
(C)
Statement I is true but Statement II is false
(D)
Statement I is false but Statement II is true
(A)

Solution

NEET 2024 Chemistry - Coordination Compounds Question 16 English Explanation 1

NEET 2024 Chemistry - Coordination Compounds Question 16 English Explanation 2

is octahedral with hybridisation and it is diamagnetic in nature. In case of [CoF6]3-, Co is in +3 oxidation state and it is having 3d6 configuration.

In presence of weak field - ligand, pairing does not take place.

NEET 2024 Chemistry - Coordination Compounds Question 16 English Explanation 3

Q.34

Given below are two statements :

Statement I : is a homoleptic complex whereas is a heteroleptic complex.

Statement II : Complex has only one kind of ligands but has more than one kind of ligands.

In the light of the above statements, choose the correct answer from the options given below.

(A)
Both Statement I and Statement II are true
(B)
Both Statement I and Statement II are false
(C)
Statement I is true but Statement II is false
(D)
Statement I is false but Statement II is true
(A)

Solution

To determine the correctness of these statements and choose the correct option, we need to understand the concepts of homoleptic and heteroleptic complexes:

Homoleptic Complex: A complex in which a central atom is surrounded by only one kind of donor atom or identical ligands is known as a homoleptic complex. An example would be , where all the ligands are ammonia ().

Heteroleptic Complex: A complex in which a central atom is surrounded by more than one kind of donor atom or different ligands is known as a heteroleptic complex, such as which contains two different types of ligands, ammonia () and chloride ().

Statement I: is a homoleptic complex whereas is a heteroleptic complex.

This statement is accurate because indeed is a homoleptic complex as it consists only of ammonia ligands. Conversely, is a heteroleptic complex, containing both ammonia and chloride ligands.

Statement II: Complex has only one kind of ligands but has more than one kind of ligands.

This statement is also true. As explained, in , there is only one type of ligand (ammonia), and in , there are two different types of ligands (ammonia and chloride), which is consistent with the definition provided.

Conclusion: Both Statement I and Statement II are true. Therefore, the correct choice is:

Option A: Both Statement I and Statement II are true

Q.35

Given below are two statements:

Statement I : The boiling point of three isomeric pentanes follows the order

n-pentane > isopentane > neopentane

Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller surface area for contact, due to which the intermolecular forces between the spherical molecules are weak, thereby lowering the boiling point.

In the light of the above statements, choose the most appropriate answer from the options given below:

(A)
Both Statement I and Statement II are correct
(B)
Both Statement I and Statement II are incorrect
(C)
Statement I is correct but Statement II is incorrect
(D)
Statement I is incorrect but Statement II is correct
(A)

Solution

The two statements provided deal with molecular structure and boiling points of isomers of pentane. Let's analyze both statements:

Statement I: This statement lists the boiling point order of the three isomers of pentane as n-pentane > isopentane > neopentane. To verify this statement, let's consider the molecular structure and boiling points of each isomer:

  • n-pentane: It is a straight-chain alkane with the formula , and it has the highest boiling point among the isomers because of its larger surface area which allows for greater van der Waals forces (dispersion forces).
  • isopentane (also known as methylbutane): It has one branch in its carbon chain. The branching reduces the surface area slightly, which slightly weakens the van der Waals forces compared to n-pentane.
  • neopentane (also known as dimethylpropane): It has a highly branched structure making it almost spherical. This shape minimizes the surface area significantly, thereby reducing the van der Waals forces drastically compared to the other two isomers.

Thus, the boiling point order correctly reflects the influence of molecular structure and intermolecular forces. Hence, Statement I is correct.

Statement II: This statement elaborates on why branching leads to lower boiling points. The assertion is that increased branching gives the molecule a more spherical shape, which then results in a smaller surface area, and thus weaker intermolecular forces (primarily van der Waals forces). Weaker intermolecular forces correspond with a lower energy requirement for the liquid to gas phase transition, thereby lowering the boiling point. This explanation is coherent with concepts in physical chemistry regarding molecular interactions and phase change. Therefore, Statement II is also correct.

In summary, both Statement I and Statement II are correct, reflecting the accurate relationship between molecular structure, intermolecular forces, and physical properties like boiling points. Therefore, the correct answer is:

Option A: Both Statement I and Statement II are correct.

Q.36

The most stable carbocation among the following is :

(A)
NEET 2024 Chemistry - Some Basic Concepts of Organic Chemistry Question 15 English Option 1
(B)
NEET 2024 Chemistry - Some Basic Concepts of Organic Chemistry Question 15 English Option 2
(C)
NEET 2024 Chemistry - Some Basic Concepts of Organic Chemistry Question 15 English Option 3
(D)
NEET 2024 Chemistry - Some Basic Concepts of Organic Chemistry Question 15 English Option 4
(D)

Solution

The stability of carbocation can be described by the hyperconjugation. Greater the extent of hyperconjugation, more is the stability of carbocation.

NEET 2024 Chemistry - Some Basic Concepts of Organic Chemistry Question 15 English Explanation

Stability order of carbocations

Q.37

A compound with a molecular formula of has two tertiary carbons. Its IUPAC name is :

(A)
n-hexane
(B)
2-methylpentane
(C)
2,3-dimethylbutane
(D)
2,2-dimethylbutane
(C)

Solution

NEET 2024 Chemistry - Some Basic Concepts of Organic Chemistry Question 14 English Explanation

Q.38

On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as

(A)
Crystallization
(B)
Sublimation
(C)
Distillation
(D)
Chromatography
(B)

Solution

The technique described in the question is known as sublimation. Sublimation is a process where a solid turns directly into a gas without passing through the intermediate liquid state. This physical change occurs under specific conditions of temperature and pressure and is characteristic of certain substances.

Option B: Sublimation is the correct answer because it directly describes the process of solid substances transforming into vapour without becoming liquid first. For example, substances like iodine, naphthalene, and dry ice (solid carbon dioxide) sublimate when heated under normal atmospheric conditions. Sublimation is not only a fascinating chemical process but is also exploited in various scientific and industrial applications, including purification of substances, where impurities do not sublimate and can thus be easily separated from the vaporized material.

The other options provided do not describe this process:

  • Crystallization (Option A) involves the formation of solid crystals from a homogeneous solution. It is typically used to purify solids wherein the impurities remain dissolved in the solvent.
  • Distillation (Option C) is a process used to separate mixtures based on differences in the conditions required to change the phase (liquid phase) of the components of the mixture. It does not involve direct transition from solid to gas.
  • Chromatography (Option D) is a method for separating components of a mixture based on differences in their movement through a stationary medium under the influence of a solvent or carrier gas. It does not involve the phase transition of solid to gas directly.
Q.39

During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of ion?

(A)
dilute hydrochloric acid
(B)
concentrated sulphuric acid
(C)
dilute nitric acid
(D)
dilute sulphuric acid
(D)

Solution

Mohr's salt is the ammonium iron(II) sulfate, with the chemical formula . It is known for its stability compared to the other iron(II) salts which tend to readily oxidize to iron(III) salts when exposed to the air. To prevent the oxidation and hydrolysis of the ion during the preparation of Mohr's salt, an acid is added. This acid serves several purposes: it maintains the acidic environment necessary to prevent hydrolysis, aids in the solubilization of iron(II) sulfate, and minimizes the oxidation of ions to .

The options provided give four different types of acids, from which one needs to be selected for the preparation of this salt. We can evaluate them based on their appropriateness:

  • Dilute Hydrochloric Acid: While capable of maintaining a low pH to prevent oxidation, HCl can potentially introduce chloride ions (), which can form complexes with iron, changing the composition of the solution.
  • Concentrated Sulphuric Acid: This choice is too strong and can lead to excessive acidity as well as potential safety issues during handling and dilution. It is unnecessary for this application.
  • Dilute Nitric Acid: Nitric acid is an oxidizing agent and can promote the oxidation of to , which is undesirable in the preparation of Mohr's salt.
  • Dilute Sulphuric Acid: This is a very common choice since it helps maintain the stability of the ion without contributing extraneous ions that could form undesired complexes or products. Moreover, it keeps the solution acidic, helping prevent oxidation and hydrolysis, while not introducing any oxidizing characteristics.

Given these considerations, the best choice for preventing hydrolysis of the ion during the preparation of Mohr's salt is Dilute Sulphuric Acid (Option D). This is because it maintains the suitable acidic conditions needed for stabilizing the ferrous ion and does not interfere with the redox stability of the iron by providing an oxidative chemical environment.

Q.40

The compound that will undergo SN1 reaction with the fastest rate is

(A)
NEET 2024 Chemistry - Haloalkanes and Haloarenes Question 6 English Option 1
(B)
NEET 2024 Chemistry - Haloalkanes and Haloarenes Question 6 English Option 2
(C)
NEET 2024 Chemistry - Haloalkanes and Haloarenes Question 6 English Option 3
(D)
NEET 2024 Chemistry - Haloalkanes and Haloarenes Question 6 English Option 4
(D)

Solution

Reactivity towards , depends upon stability of carbocation.

Order of stability is

NEET 2024 Chemistry - Haloalkanes and Haloarenes Question 6 English Explanation

Q.41

Identify the major product C formed in the following reaction sequence :

(A)
propylamine
(B)
butylamine
(C)
butanamide
(D)
-bromobutanoic acid
(A)

Solution

NEET 2024 Chemistry - Haloalkanes and Haloarenes Question 5 English Explanation

Step-l is reaction with nucleophile.

Step-II will give amide.

Step-III is Hoffmann bromamide degradation reaction.

Q.42

Which one of the following alcohols reacts instantaneously with Lucas reagent?

(A)
(B)
NEET 2024 Chemistry - Alcohol, Phenols and Ethers Question 7 English Option 2
(C)
NEET 2024 Chemistry - Alcohol, Phenols and Ethers Question 7 English Option 3
(D)
NEET 2024 Chemistry - Alcohol, Phenols and Ethers Question 7 English Option 4
(D)

Solution

Tertiary alcohols react instantaneously with Lucas reagent and gives immediate turbidity. In case of tertiary alcohols, they form halides easily with Lucas reagent (conc. and )

Q.43

The products and obtained in the following reactions, respectively, are

(A)
and
(B)
and
(C)
and
(D)
and
(D)

Solution

Let's analyze the given reactions and determine the products and .

Reaction with PCl3:

When an alcohol () reacts with phosphorus trichloride (), the hydroxyl group () of the alcohol is replaced by a chloro group (), resulting in the formation of an alkyl chloride (). Additionally, the reaction produces phosphorous acid as a byproduct. This can be represented as:

Here, is (phosphorous acid).

Reaction with PCl5:

When an alcohol reacts with phosphorus pentachloride (), it also replaces the hydroxyl group with a chloro group. The reaction differs slightly in the byproducts; phosphorus oxychloride () and hydrogen chloride () are produced:

Here, is (phosphorus oxychloride).

Thus, in the reactions provided:

Matching these findings against the provided options, we see that Option D correctly identifies as and as :

Option D: and

This is the correct answer.

Q.44

Major products A and B formed in the following reaction sequence, are

NEET 2024 Chemistry - Alcohol, Phenols and Ethers Question 8 English

(A)
NEET 2024 Chemistry - Alcohol, Phenols and Ethers Question 8 English Option 1
(B)
NEET 2024 Chemistry - Alcohol, Phenols and Ethers Question 8 English Option 2
(C)
NEET 2024 Chemistry - Alcohol, Phenols and Ethers Question 8 English Option 3
(D)
NEET 2024 Chemistry - Alcohol, Phenols and Ethers Question 8 English Option 4
(A)

Solution

NEET 2024 Chemistry - Alcohol, Phenols and Ethers Question 8 English Explanation

Q.45

Identify the correct reagents that would bring about the following transformation.

NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 10 English

(A)

(i)

(ii)

(B)

(i)

(ii)

(iii) PCC

(C)

(i)

(ii)

(iii) alk.

(D)

(i)

(ii) PCC

(B)

Solution

NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 10 English Explanation

Q.46

Match List I with List II.

List I
(Reaction)
List II
(Reagents/Condition)
A. NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 12 English 1 I. NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 12 English 2
B. NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 12 English 3 II. CrO
C. NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 12 English 4 III. KMnO/KOH,
D. NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 12 English 5 IV. (i) O
(ii) Zn-HO

Choose the correct answer from the options given below:

(A)
A-IV, B-I, C-III, D-II
(B)
A-III, B-I, C-II, D-IV
(C)
A-IV, B-I, C-II, D-III
(D)
A-I, B-IV, C-II, D-III
(C)

Solution

NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 12 English Explanation 1

NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 12 English Explanation 2

NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 12 English Explanation 3

NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 12 English Explanation 4

Q.47

For the given reaction:

NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 11 English

'P' is

(A)
NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 11 English Option 1
(B)
NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 11 English Option 2
(C)
NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 11 English Option 3
(D)
NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 11 English Option 4
(B)

Solution

NEET 2024 Chemistry - Aldehydes, Ketones and Carboxylic Acids Question 11 English Explanation

Q.48

Given below are two statements:

Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction.

Statement II : Aniline cannot be prepared through Gabriel synthesis.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both statement I and Statement II are true
(B)
Both Statement I and Statement II are false
(C)
Statement I is correct but Statement II is false
(D)
Statement I is incorrect but Statement II is true
(A)

Solution

Aniline does not undergo Friedel-Crafts alkylation reaction due to salt formation with aluminium chloride, the Lewis acid, which is used as a catalyst.

Aniline (aromatic primary amine) cannot be prepared by Gabriel phthalimide synthesis because aryl halides do not undergo nucleophilic substitution with anion formed by phthalimide.

Q.49

The reagents with which glucose does not react to give the corresponding tests/products are

A. Tollen's reagent

B. Schiff's reagent

C. HCN

D.

E.

Choose the correct options from the given below:

(A)
B and C
(B)
A and D
(C)
B and E
(D)
E and D
(C)

Solution

Let's analyze each reagent and its reaction with glucose to determine which ones do not react accordingly.

Glucose is an aldohexose, meaning it has an aldehyde group in its straight-chain form and can form a cyclic hemiacetal structure. This structure is predominant under physiological conditions.

A. Tollen's Reagent: Tollen's reagent is a solution of silver nitrate in ammonia, used to detect reducing sugars. Glucose, having a free aldehyde group or an easily openable hemiacetal in its cyclic form, can reduce Tollen's reagent to metallic silver, showing a positive test. Thus, glucose reacts with Tollen's reagent.

B. Schiff's Reagent: Schiff's reagent is used to detect aldehydic groups. It is sensitive to free aldehydes, turning pink when aldehydes are present. Since the aldehyde form of glucose is present in very minute amounts at equilibrium (most glucose is in the cyclic form), it generally does not react strongly with Schiff's reagent, leading to a negative test.

C. HCN: Hydrogen cyanide (HCN) can react with carbonyl groups to form cyanohydrins. In the case of glucose, the reactive aldehyde group can react with HCN to form glucosyl cyanohydrin. Thus, glucose does react with HCN.

D. (Hydroxylamine): Hydroxylamine reacts with carbonyl compounds to form oximes. Glucose, containing an aldehyde group, can react with hydroxylamine to form glucose oxime. Therefore, glucose reacts with hydroxylamine.

E. (Sodium Bisulfite): Sodium bisulfite reacts with aldehydes to form bisulfite adducts. However, because glucose in solution predominantly exists in its cyclic form rather than the open-chain form, it does not readily react with sodium bisulfite. Hence, glucose generally does not react with sodium bisulfite, unless placed under certain conditions that favor the open-chain form.

In conclusion, the reagents with which glucose does not react to give the corresponding tests/products are:

B. Schiff's Reagent and

E.

Therefore, the correct answer is Option C: B and E.

Q.50

Fehling's solution 'A' is

(A)
aqueous copper sulphate
(B)
alkaline copper sulphate
(C)
alkaline solution of sodium potassium tartrate (Rochelle's salt)
(D)
aqueous sodium citrate
(A)

Solution

Fehling's solution is a chemical reagent used to differentiate between water-soluble carbohydrates and ketone-functional groups, and as a test for monosaccharides. It is used specially in the Fehling's test for reducing sugars. The test involves two solutions, generally known as Fehling's A and Fehling's B, which are mixed together and added to perform the test.

Fehling's solution 'A' is an aqueous solution of copper(II) sulfate. Thus, the correct option is:

Option A: aqueous copper sulphate

The function of Fehling's A is to provide copper(II) ions, , which act as the oxidizing agent in the reaction with the reducing sugar. When Fehling's Solution A and B are mixed and heated with a reducing sugar, the copper(II) ions are reduced to copper(I) oxide, which precipitates as a red solid, indicating a positive result.

Fehling's Solution B, on the other hand, contains alkaline sodium potassium tartrate, which helps to maintain the solution in an alkaline condition and keeps the copper(II) ions in solution.

Thus, in summary, Fehling's A consists of aqueous copper sulfate, which directly matches with Option A.

Biology (Maximum Marks: 400)
  • This section contains 100 questions.
  • Each question has FOUR options (A), (B), (C) and (D). ONLY ONE of these four options is the correct answer.
  • Full Marks : +4 If ONLY the correct option is chosen;
  • Zero Marks : 0 If none of the options is chosen (i.e. the question is unanswered);
  • Negative Marks : −1 In all other cases.
Q.1

Match List I with List II

List - I List - II
A. Nucleolus I. Site of formation of glycolipid
B. Centriole II. Organization like the cartwheel
C. Leucoplasts III. Site of active ribosomal RNA synthesis
D. Golgi apparatus IV. For storing nutrients

Choose the correct answer from the options given below:

(A)
A-III, B-II, C-IV, D-I
(B)
A-II, B-III, C-I, D-IV
(C)
A-III, B-IV, C-II, D-I
(D)
A-I, B-II, C-III, D-IV
(A)

Solution

Let's analyze each item in List I and the correct match in List II.

Nucleolus (A) is primarily known as the site where ribosomal RNA (rRNA) is synthesized and where initial ribosome assembly occurs. Thus, it matches perfectly with III. Site of active ribosomal RNA synthesis.

Centriole (B) is a cylindrical cellular structure composed of microtubules and is best known for its role in facilitating cell division, especially in the formation of the spindle apparatus. Its structure is often described as being like a cartwheel, which makes it accurately matched with II. Organization like the cartwheel.

Leucoplasts (C) are a type of non-pigmented plastid found in plant cells, primarily involved in the storage of important nutrients such as starch, oils, and proteins. Hence, the appropriate pair is IV. For storing nutrients.

Golgi apparatus (D) functions in the sorting, modifying, and packaging of macromolecules for cell secretion or for use within the cell. It includes the synthesis of glycolipids among its activities. Consequently, the correct match is I. Site of formation of glycolipid.

With these correlations, the correct matches are:

  • A - III,
  • B - II,
  • C - IV,
  • D - I

Therefore, the correct option is Option A:

.

Q.2

The DNA present in chloroplast is:

(A)
Linear, double stranded
(B)
Circular, double stranded
(C)
Linear, single stranded
(D)
Circular, single stranded
(B)

Solution

Chloroplasts are organelles found in the cells of plants and of some other organisms that carry out photosynthesis. They contain their own genetic material, separated from the DNA found in the nucleus of the cell. The DNA in chloroplasts has a distinct structure and form.

The DNA within chloroplasts is mostly:

- Circular: The DNA forms a closed loop, similar to the DNA found in bacteria. This similarity supports the endosymbiotic theory, which proposes that chloroplasts originated as free-living prokaryotes that were engulfed by ancestral eukaryotic cells.

- Double-stranded: Like most DNA, the DNA in chloroplasts is made up of two complementary strands that wind around each other to form a double helix.

Based on this information, the correct answer to your query about the form of DNA present in chloroplasts is:

Option B: Circular, double stranded

Q.3

Match List I with List II :

List - I List - II
A. Axoneme I. Centriole
B. Cartwheel pattern II. Cilia and flagella
C. Crista III. Chromosome
D. Satellite IV. Mitochondria

Choose the correct answer from the options given below :

(A)
A-IV, B-III, C-II, D-I
(B)
A-IV, B-II, C-III, D-I
(C)
A-II, B-IV, C-I, D-III
(D)
A-II, B-I, C-IV, D-III
(D)

Solution

The correct matching between List I and List II can be understood by knowing the respective functions or structural components of the mentioned items:

  • Axoneme: This is the core of cilia or flagella, consisting of microtubules arranged in a characteristic pattern. This hence matches with II 'Cilia and flagella'.
  • Cartwheel pattern: The term 'cartwheel structure' is specifically associated with the central hub of the centriole's microtubule triplet arrangements in cellular structures. Therefore, this matches with I 'Centriole'.
  • Crista: Cristae are the internal membranes of mitochondria that are folded into ridges, involved in the mitochondrial energy generation. Therefore, C matches with IV 'Mitochondria'.
  • Satellite: In a cellular context, satellites typically refer to certain types of secondary structures or appendages associated with nucleic acids, hence best matching with III 'Chromosome'.

Thus, matching the correct items gives us:

A-II, B-I, C-IV, D-III.

This corresponds to Option D.

Q.4

Given below are two statements:

Statement I: Mitochondria and chloroplasts both double membranes bound organelles.

Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast.

In the light of the above statements, choose the mis appropriate answer from the options given below:

(A)
Both Statement I and Statement II are correct.
(B)
Both Statement I and Statement II are incorrect.
(C)
Statement I is correct but Statement II is incorrect.
(D)
Statement I is incorrect but Statement II is correct.
(C)

Solution

Both mitochondria and chloroplasts are double membrane bound cell organelles.

Transport of ions occurs across the inner membrane of mitochondria. The inner membrane of chloroplast is impermeable to ions and metabolites. Therefore, it is said that inner membrane of mitochondria is relatively more permeable to that of chloroplast.

Q.5

Lecithin, a small molecular weight organic compound found in living tissues, is an example of:

(A)
Amino acids
(B)
Phospholipids
(C)
Glycerides
(D)
Carbohydrates
(B)

Solution

The correct answer is option (2).

Some lipids have phosphorous and a phosphorylated organic compound in them. These are phospholipids. They are found in cell membrane. Lecithin is one example.

Option (3) is incorrect as glycerides are another group of lipids in which both glycerol and fatty acids are present.

Option (1) and (2) are incorrect as amino acids and carbohydrates are separate groups of biomolecules.

Q.6

The cofactor of the enzyme carboxypeptidase is:

(A)
Zinc
(B)
Niacin
(C)
Flavin
(D)
Haem
(A)

Solution

The enzyme carboxypeptidase is well-known for its utilization of a zinc ion as a cofactor in its catalytic mechanism. The zinc ion plays a crucial role in the hydrolysis of peptide bonds, the reaction facilitated by carboxypeptidase. The presence of zinc allows for proper stabilization of water molecules which are necessary in the catalysis, making the hydrolysis of the peptide bond effective. This zinc dependency categorizes carboxypeptidase as a metalloenzyme.

Therefore, the correct answer is:

Option A: Zinc

Other options mentioned, such as Niacin, Flavin, and Haem, serve as cofactors for different enzymes. For example, Niacin is involved in the formation of NAD+ (Nicotinamide adenine dinucleotide) which acts as an electron carrier in many enzymatic reactions. Flavins (like FMN and FAD) are involved in a myriad of oxidation-reduction (redox) reactions. Haem, found in hemoglobin and cytochromes, also plays crucial roles primarily in electron transfer processes and oxygen transport. These are not associated with the functioning of carboxypeptidase, which specifically requires zinc for its enzymatic activity.

Q.7

Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

(A)
Cofactor inhibition
(B)
Feedback inhibition
(C)
Competitive inhibition
(D)
Enzyme activation
(C)

Solution

The inhibition of the enzyme succinic dehydrogenase by malonate is a classic example of competitive inhibition. To understand why this is the case, let's explore the mechanism and dynamics of this specific type of inhibition in the context of the given enzyme and inhibitor.

Competitive Inhibition: This type of enzyme inhibition occurs when an inhibitor compound resembles the substrate's structure and competes with the substrate for binding to the active site of the enzyme. If the inhibitor binds to the active site, it prevents the substrate from binding, temporarily blocking the enzyme’s activity. Importantly, competitive inhibition can typically be overcome by increasing the concentration of the substrate, as this can displace the inhibitor from the active site.

Succinic Dehydrogenase and Malonate: Succinic dehydrogenase is an enzyme that plays a critical role in the citric acid cycle, an essential metabolic pathway for energy production. It catalyzes the oxidation of succinate into fumarate. The structure of malonate is closely similar to that of succinate, the natural substrate of succinic dehydrogenase. Because of its structural similarity, malonate competes with succinate for the active site on succinic dehydrogenase. When malonate binds to the active site, it effectively inhibits the enzyme from catalyzing the reaction to convert succinate into fumarate.

Conclusion: Considering these points, Option C, Competitive inhibition, is correct for describing the inhibition of succinic dehydrogenase by malonate, as it directly competes with the substrate for the active site of the enzyme.

Other options such as cofactor inhibition, feedback inhibition, and enzyme activation do not accurately describe the situation with malonate and succinic dehydrogenase. Cofactor inhibition involves inhibition by substances that affect the enzyme's cofactors, feedback inhibition generally pertains to the regulation of biochemical pathways by their product, and enzyme activation is a process that increases the enzyme's activity, none of which apply in this context.

Q.8

Match List I with List II

List - I List - II
A. GLUT-4 I. Hormone
B. Insulin II. Enzyme
C. Trypsin III. Intercellular ground substance
D. Collagen IV. Enables glucose transport into cells

Choose the correct answer from the options given below.

(A)
A-IV, B-I, C-II, D-III
(B)
A-I, B-II, C-III, D-IV
(C)
A-II, B-III, C-IV, D-I
(D)
A-III, B-IV, C-I, D-II
(A)

Solution

To solve this matching question, we need to correctly identify what each item in List I represents and match it with its corresponding description in List II:

  • GLUT-4 is a glucose transporter protein that allows glucose to be absorbed into cells when insulin is present. Hence, it should be matched with "Enables glucose transport into cells."
  • Insulin is a hormone produced by the pancreas that helps regulate blood glucose levels by facilitating the uptake of glucose into tissues. It should be matched with "Hormone."
  • Trypsin is an enzyme that aids in the digestion of proteins in the digestive system. It should be matched with "Enzyme."
  • Collagen is a primary structural protein that forms connective tissues throughout the body, including the extracellular matrix. It should be matched with "Intercellular ground substance."

Here's how we match each term with the correct description from List II:

A-IV, B-I, C-II, D-III

This corresponds to:

  • A (GLUT-4) - IV (Enables glucose transport into cells)
  • B (Insulin) - I (Hormone)
  • C (Trypsin) - II (Enzyme)
  • D (Collagen) - III (Intercellular ground substance)

Therefore, the answer is Option A:

A-IV, B-I, C-II, D-III

Q.9

Match List I with List II:

List - I List - II
A. Lipase I. Peptide bond
B. Nuclease II. Ester bond
C. Protease III. Glycosidic bond
D. Amylase IV. Phosphodiester bond

Choose the correct answer from the options given below :

(A)
A-IV, B-II, C-III, D-I
(B)
A-III, B-II, C-I, D-IV
(C)
A-II, B-IV, C-I, D-III
(D)
A-IV, B-I, C-III, D-II
(C)

Solution

The task here is to correctly match the enzymes listed in List I with their corresponding type of bond they hydrolyze or act on, as listed in List II. To do this, we need to understand the function of each enzyme:

  • Lipase: This enzyme catalyzes the breakup of fats (lipids), primarily working on the ester bonds in triglycerides. Thus, Lipase corresponds to Ester bond (II).
  • Nuclease: Nucleases are enzymes that cleave the phosphodiester bonds within the nucleic acids, DNA and RNA. Therefore, Nuclease corresponds to Phosphodiester bond (IV).
  • Protease: These enzymes hydrolyze proteins by breaking peptide bonds between amino acids. Thus, Protease matches with Peptide bond (I).
  • Amylase: Amylase acts on starches, breaking down the glycosidic bonds in carbohydrate molecules to produce simple sugars. Hence, Amylase corresponds to Glycosidic bond (III).

Matching these to the given options:

  • A - Lipase corresponds to Ester bond (II).
  • B - Nuclease corresponds to Phosphodiester bond (IV).
  • C - Protease corresponds to Peptide bond (I).
  • D - Amylase corresponds to Glycosidic bond (III).

This matches with Option C, hence the correct response is:

Option C: A-II, B-IV, C-I, D-III.

Q.10

Regarding catalytic cycle of an enzyme action, select the correct sequential steps :

A. Substrate enzyme complex formation.

B. Free enzyme ready to bind with another substrate.

C. Release of products.

D. Chemical bonds of the substrate broken.

E. Substrate binding to active site.

Choose the correct answer from the options given below :

(A)
E, A, D, C, B
(B)
A, E, B, D, C
(C)
B, A, C, D, E
(D)
E, D, C, B, A
(A)

Solution

The correct order of the steps in the catalytic cycle of enzyme action involves the following key events:

  1. Substrate binding to the active site: Before any reaction can take place, the substrate must bind to the enzyme's active site. This is where the substrate is correctly positioned for the reaction.
  2. Formation of the substrate-enzyme complex: Once the substrate binds to the active site, a substrate-enzyme complex is formed. This complex stabilizes the transition state of the reaction and lowers the activation energy required for the reaction.
  3. Chemical bonds of the substrate broken : Within the substrate-enzyme complex, the specific chemical reaction occurs, leading to the breaking of bonds within the substrate. This step often involves changes to the chemical structure of the substrate, turning it into the product(s) of the reaction.
  4. Release of products: After the reaction occurs, the product(s) of the reaction are released from the enzyme, leaving the enzyme unchanged.
  5. Free enzyme ready to bind with another substrate: Once the product is released, the enzyme is free again to bind with another substrate, repeating the cycle.

Given the correct sequence and your provided options, the correct answer is:

Option A: E, A, D, C, B

This sequence correctly describes the steps involved in the catalytic cycle of enzyme action, from substrate binding to the release of products and the readiness of the enzyme to start a new cycle.

Q.11

Spindle fibers attach to kinetochores of chromosomes during

(A)
Prophase
(B)
Metaphase
(C)
Anaphase
(D)
Telophase
(B)

Solution

During the process of mitosis, spindle fibers play a crucial role in the movement and alignment of chromosomes. These fibers are made of microtubules and are essential for the chromosomes to move accurately into position during cell division. Let's discuss when the spindle fibers attach to the kinetochores of the chromosomes:

  • Prophase: This is the initial stage of mitosis, where the chromosomes condense and become visible. However, the spindle fibers have not yet attached to kinetochores. Spindle fibers begin to form, but their attachment to kinetochores happens later.
  • Metaphase: This is the stage where the spindle fibers attach to the kinetochores of chromosomes. During metaphase, chromosomes align at the metaphase plate (also known as the equatorial plane of the cell). This alignment is facilitated by the spindle fibers, which pull the chromosomes into position for accurate separation into daughter cells.
  • Anaphase: During anaphase, the sister chromatids separate and are pulled apart as the spindle fibers shorten. While spindle fibers are essential during this phase for pulling apart the chromatids, their initial attachment to kinetochores occurs earlier.
  • Telophase: This is the final stage of mitosis, where the chromosomes reach the opposite poles of the cell, and the cell starts to re-form its nuclear membranes. Spindle fibers disassemble during this phase.

Based on the description of functions and timing within mitosis, the correct answer for when spindle fibers attach to kinetochores of chromosomes is Option B: Metaphase.

Q.12

Given below are two statements:

Statement I : Chromosomes become gradually visible under light microscope during leptotene stage.

Statement II : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are true
(B)
Both Statement I and Statement II are false
(C)
Statement I is true but Statement II is false
(D)
Statement I is false but Statement II is true
(A)

Solution

The two statements in question are related to specific stages of meiosis, specifically prophase I. Understanding these stages will help us decide the accuracy of the statements.

Statement I: Chromosomes become gradually visible under light microscope during leptotene stage.

Analysis of Statement I: During the leptotene stage of prophase I in meiosis, chromatin begins to condense, making chromosomes more visible under the light microscope. However, it is important to note that the chromosomes are not fully condensed at this stage. They continue condensing in the later stages (zygotene and pachytene). Therefore, the statement is largely accurate as it reflects the initial visibility of the chromosomes.

Statement II: The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.

Analysis of Statement II: In the diplotene stage of prophase I, the previously formed synaptonemal complexes, which assist in the pairing of homologous chromosomes during the earlier zygotene and pachytene stages, start to dissolve. This dissolution marks the transition into diplotene and is a key event that defines this stage. So, this statement is true.

Given that the analysis shows both statements to be accurate in their description of events during meiosis, the most appropriate choice is:

Option A: Both Statement I and Statement II are true.

Q.13

Following are the stages of cell division :

A. Gap 2 phase

B. Cytokinesis

C. Synthesis phase

D. Karyokinesis

E. Gap 1 phase

Choose the correct sequence of stages from the options given below :

(A)
C-E-D-A-B
(B)
E-B-D-A-C
(C)
B-D-E-A-C
(D)
E-C-A-D-B
(D)

Solution

The correct sequence of stages of cell division is

Q.14

Match List I with List II :

List - I
(Sub Phases of Prophase I)
List - II
(Specific Characters)
A. Diakinesis I. Synaptonemal complex formation
B. Pachytene II. Completion of terminalisation of chiasmata
C. Zygotene III. Chromosomes look like thin threads
D. Leptotene IV. Appearance of recombination nodules

Choose the correct answer from the options given below

(A)
A-IV, B-II, C-III, D-I
(B)
A-I, B-II, C-IV, D-III
(C)
A-II, B-IV, C-I, D-III
(D)
A-IV, B-III, C-II, D-I
(C)

Solution

The matching between the sub-phases of Prophase I and their specific characters can be understood as follows:

List I (Sub Phases of Prophase I):

  • Leptotene: This is the first stage where chromosomes start to become visible under the microscope as thin, thread-like structures. Hence, it is characterized by chromosomes looking like thin threads.
  • Zygotene: During this stage, synapsis begins, which is the pairing of homologous chromosomes. This corresponds to the formation of the synaptonemal complex.
  • Pachytene: At this stage, crossing over occurs where genetic material is exchanged between homologous chromosomes. Appearance of recombination nodules, which are essential for crossing over, characterizes this stage.
  • Diakinesis: This is the final stage of prophase I where chiasmata (the site of crossing over) move to the ends of the chromosomes, a process known as terminalization. Hence, this phase is marked by the completion of terminalization of chiasmata.

List II (Specific Characters):

  • I. Synaptonemal complex formation - Characteristic of Zygotene.
  • II. Completion of terminalisation of chiasmata - Characteristic of Diakinesis.
  • III. Chromosomes look like thin threads - Characteristic of Leptotene.
  • IV. Appearance of recombination nodules - Characteristic of Pachytene.

Matching the sub-phases to their characters:

  • A (Diakinesis) matches with II (Completion of terminalisation of chiasmata).
  • B (Pachytene) matches with IV (Appearance of recombination nodules).
  • C (Zygotene) matches with I (Synaptonemal complex formation).
  • D (Leptotene) matches with III (Chromosomes look like thin threads).

Thus, the correct answer is Option C:

A-II, B-IV, C-I, D-III.

Q.15

Identify the set of correct statements:

A. The flowers of Vallisneria are colourful and produce nectar.

B. The flowers of water lily are not pollinated by water.

C. In most of water-pollinated species, the pollen grains are protected from wetting.

D. Pollen grains of some hydrophytes are long and ribbon like.

E. In some hydrophytes, the pollen grains are carried passively inside water.

Choose the correct answer from the options given below.

(A)
C, D and E only
(B)
A, B, C and D only
(C)
A, C, D and E only
(D)
B, C, D and E only
(D)

Solution

To determine the correct set of statements, we need to analyze each statement individually based on the characteristics of water-pollinated plants and specific examples given:

Statement A: "The flowers of Vallisneria are colourful and produce nectar."

This statement is incorrect. Vallisneria is an example of a water-pollinated (hydrophilous) plant. Unlike insect-pollinated flowers, which are often colorful and produce nectar to attract pollinators, water-pollinated flowers typically lack bright colors and nectar because they do not need to attract insects or other animals. Vallisneria flowers are small and inconspicuous.

Statement B: "The flowers of water lily are not pollinated by water."

This statement is correct. Water lilies are typically pollinated by insects, not by water. The large and colorful flowers of water lilies are adapted to attract insect pollinators, contrasting starkly with the typical features of water-pollinated flowers.

Statement C: "In most of water-pollinated species, the pollen grains are protected from wetting."

This statement is correct. In water-pollinated plants, the pollen grains often have a covering or are structured in a way that prevents them from becoming waterlogged and sinking. This adaptation allows them to float on the water's surface and reach the female parts of other plants.

Statement D: "Pollen grains of some hydrophytes are long and ribbon like."

This statement is correct. In some water-pollinated plants, such as seagrasses (e.g., Zostera), the pollen grains are indeed elongated and ribbon-like, which helps them to be transported more effectively by water currents.

Statement E: "In some hydrophytes, the pollen grains are carried passively inside water."

This statement is also correct. Many hydrophytes have pollen grains that are transported by water currents, rather than being actively carried by animal pollinators or the wind. This passive transport is typical in water-pollinated species.

Based on the analysis, Statements B, C, D, and E are correct, while Statement A is incorrect. Therefore, the correct answer is:

Option D: B, C, D, and E only

Q.16

Identify the correct description about the given figure :

NEET 2024 Biology - Sexual Reproduction in Flowering Plants Question 17 English

(A)
Wind pollinated plant inflorescence showing flowers with well exposed stamens.
(B)
Water pollinated flowers showing stamens with mucilaginous covering.
(C)
Cleistogamous flowers showing autogamy.
(D)
Compact inflorescence showing complete autogamy
(A)

Solution

The given diagram shows a wind pollinated plant showing compact inflorescence and well exposed stamens.

Stamens are exposed so complete autogamy does not occur.

Q.17

Match List I with List II

List - I List - II
A. Clostridium butylicum I. Ethanol
B. Saccharomyces cerevisiae II. Streptokinase
C. Trichoderma polysporum III. Butyric acid
D. Streptococcus sp. IV. Cyclosporin-A

Choose the correct answer from the options given below:

(A)
A-III, B-I, C-II, D-IV
(B)
A-II, B-IV, C-III, D-I
(C)
A-III, B-I, C-IV, D-II
(D)
A-IV, B-I, C-III, D-II
(C)

Solution

Q.18

In the given figure, which component has thin outer walls and highly thickened inner walls?

NEET 2024 Biology - Anatomy of Flowering Plants Question 8 English

(A)
C
(B)
D
(C)
A
(D)
B
(A)

Solution

Guard cells to stomata have thin outer wall and highly thickened inner walls.

Q.19

Given below are two statements:

Statement I : Parenchyma is living but collenchyma is dead tissue.

Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are true
(B)
Both Statement I and Statement II are false
(C)
Statement I is true but Statement II is false
(D)
Statement I is false but Statement II is true
(D)

Solution

Let's analyze each statement separately to determine the correct answer:

Statement I: Parenchyma is living but collenchyma is dead tissue.

This statement is incorrect. Parenchyma and collenchyma are both types of simple tissues found in plants. Parenchyma is indeed a living tissue comprised of cells that are often involved in metabolic processes, storage, and photosynthesis. Collenchyma, similarly, is also a living tissue. It is known for providing support and mechanical strength to growing parts of a plant such as leaves and stems, particularly in areas where growth is active. The cells of collenchyma are elongated and have thicker primary walls compared to parenchyma, but they are definitely living.

Statement II: Gymnosperms lack xylem vessels but the presence of xylem vessels is the characteristic of angiosperms.

This statement is true. Gymnosperms are a group of seed-producing plants that include conifers, cycads, Ginkgo, and Gnetales. One of the distinguishing features of gymnosperms is that their xylem consists of tracheids but lacks vessels. Tracheids are elongated cells in the xylem of vascular plants that facilitate the transport of water and mineral salts. On the other hand, angiosperms, or flowering plants, have a more advanced xylem that contains both tracheids and vessels. Vessels are more efficient at transporting water than tracheids, which is one of the evolutionary advantages of angiosperms over gymnosperms.

Therefore, considering the above explanations:

  • Statement I is false as both parenchyma and collenchyma are living tissues.
  • Statement II is true regarding the absence of xylem vessels in gymnosperms and their presence in angiosperms.

Based on the analysis, the correct answer is:

Option D: Statement I is false but Statement II is true

Q.20

Match List I with List II

List - I List - II
A. Citric acid cycle I. Cytoplasm
B. Glycolysis II. Mitochondrial matrix
C. Electron transport system III. Intermembrane space of mitochondria
D. Proton gradient IV. Inner mitochondrial membrane

Choose the correct answer from the options given below:

(A)
A-I, B-II, C-III, D-IV
(B)
A-II, B-I, C-IV, D-III
(C)
A-III, B-IV, C-I, D-II
(D)
A-IV, B-III, C-II, D-I
(B)

Solution

To correctly match the given processes in List I with their locations in List II, let's go through each item:

  • Citric Acid Cycle (A) occurs in the mitochondrial matrix. This process, also known as the Krebs cycle, takes place in the matrix of mitochondria where enzymes for the cycle are located.

  • Glycolysis (B) takes place in the cytoplasm of the cell. It is the process of breaking down glucose into pyruvate, generating small amounts of energy (ATP) and does not involve the mitochondria.

  • Electron Transport System (C) occurs at the inner mitochondrial membrane. This is where the electron transport chains are located and where ATP is produced by oxidative phosphorylation.

  • Proton Gradient (D) is involved in the creation of ATP and is formed across the intermembrane space of the mitochondria. Protons (H+ ions) are pumped from the mitochondrial matrix to the intermembrane space, creating a gradient that drives ATP synthesis.

Now using the above information, let's match these with the correct options:

  • A. Citric Acid Cycle - II. Mitochondrial Matrix
  • B. Glycolysis - I. Cytoplasm
  • C. Electron Transport System - IV. Inner Mitochondrial Membrane
  • D. Proton Gradient - III. Intermembrane Space of Mitochondria

Comparing these to the options provided:

  • Option A: A-I, B-II, C-III, D-IV - Incorrect
  • Option B: A-II, B-I, C-IV, D-III - Correct
  • Option C: A-III, B-IV, C-I, D-II - Incorrect
  • Option D: A-IV, B-III, C-II, D-I - Incorrect

Therefore, Option B is the correct match:

A-II, B-I, C-IV, D-III

Q.21

Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.

(A)
Malic acid Oxaloacetic acid
(B)
Succinic acid Malic acid
(C)
Succinyl-CoA Succinic acid
(D)
Isocitrate -ketoglutaric acid
(C)

Solution

The tricarboxylic acid cycle (TCA cycle), also known as the Krebs cycle or citric acid cycle, is a series of enzyme-catalyzed chemical reactions that form a key part of aerobic respiration in cells. This cycle is primarily used to generate high-energy electron carriers and carbon dioxide. Most of the steps in the TCA cycle involve the oxidation of the substrate, where electrons are transferred to NAD+ to form NADH or to FAD to form FADH2.

Each option provided corresponds to a step in the TCA cycle:

  • Option A: Malic acid Oxaloacetic acid involves the enzyme malate dehydrogenase, where malate is oxidized to oxaloacetate. NAD+ is reduced to NADH in this process, indicating an oxidation reaction.

  • Option B: Succinic acid Malic acid is not a direct step in the TCA cycle. Instead, succinic acid is first converted to fumarate by succinate dehydrogenase, involving the reduction of FAD to FADH2, then fumarate is hydrated to malate by fumarase. Both involve transformations but particularly the conversion of succinate to fumarate involves oxidation.

  • Option C: Succinyl-CoA Succinic acid involves the conversion of Succinyl-CoA to Succinic acid catalyzed by succinyl-CoA synthetase. In this process, a high-energy thioester bond in Succinyl-CoA is broken to release a molecule of coenzyme A (CoA) and produce succinate. This step does not involve the transfer of electrons or the reduction of NAD+ or FAD; rather, it's coupled with the phosphorylation of GDP to GTP (or ADP to ATP in some organisms), which is a substrate-level phosphorylation.

  • Option D: Isocitrate -ketoglutaric acid involves the enzyme isocitrate dehydrogenase that catalyzes the oxidative decarboxylation of isocitrate into alpha-ketoglutarate. NAD+ is reduced to NADH, showing that this step involves oxidation.

Therefore, the correct answer is Option C (Succinyl-CoA Succinic acid). This is the step in the TCA cycle that does not involve the oxidation of the substrate but instead involves substrate-level phosphorylation, which is associated with the energy conversion of GTP formation rather than an electron transfer process.

Q.22

Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:

(A)
8 bp
(B)
6 bp
(C)
4 bp
(D)
10 bp
(B)

Solution

The correct answer is option (2).

The first restriction endonuclease - Hind II, whose functioning depends on a specific DNA nucleotide sequence was isolated. It was found that Hind II always cut DNA molecules at a particular point by recognising sequence of six base pairs.

Option (1), (3) and (4) are incorrect because they have either more than 6 or less than .

Q.23

The "Ti plasmid" of Agrobacterium tumefaciens stands for

(A)
Tumour inhibiting plasmid
(B)
Tumor independent plasmid
(C)
Tumor inducing plasmid
(D)
Temperature independent plasmid
(C)

Solution

The correct answer is Option C: Tumor inducing plasmid.

The "Ti plasmid" is a type of plasmid (a small DNA molecule within a cell that is physically separated from chromosomal DNA and can replicate independently) found in the bacterium Agrobacterium tumefaciens. This bacterium is known for its ability to transfer a segment of its DNA to a plant, integrating this DNA into the plant's genome, causing the plant to develop tumors, known as crown gall disease.

The term "Ti plasmid" stands for "Tumor inducing plasmid" because of its role in this process. When Agrobacterium tumefaciens infects a plant, the Ti plasmid transfers a portion of its DNA-known as T-DNA (transfer DNA)-into a random site in the plant's genome. The expression of genes in the T-DNA leads to the overproduction of certain growth hormones (auxins and cytokinins), which results in the formation of tumors on the plant.

Thus, Option C "Tumor inducing plasmid" most accurately describes the Ti plasmid's function of inducing tumor formation in infected plants. Options A, B, and D do not correctly describe the properties or functions of the Ti plasmid.

Q.24

The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called

(A)
in-situ conservation
(B)
Biodiversity conservation
(C)
Semi-conservative method
(D)
Sustainable development
(B)

Solution

The type of conservation in which threatened species are taken out from their natural habitat and placed in special setting where they can be protected and given special care is called ex-situ conservation which is a type of biodiversity conservation.

Q.25

These are regarded as major causes of biodiversity loss:

A. Over exploitation

B. Co-extinction

C. Mutation

D. Habitat loss and fragmentation

E. Migration

Choose the correct option:

(A)
A, C and D only
(B)
A, B, C and D only
(C)
A, B and E only
(D)
A, B and D only
(D)

Solution

The major causes of biodiversity loss primarily involve the negative impacts human activities have on ecosystems, with some of the most critical factors being:

  • Overexploitation: This refers to the unsustainable use of wildlife and plant species for food, medicine, or other human needs which leads to the reduction in numbers of these species to dangerously low levels.
  • Co-extinction: This occurs when the extinction of one species leads to the extinction of another species that depend on it for survival, such as a predator and its prey or a plant and its pollinator.
  • Habitat loss and fragmentation: This is the process whereby a large, continuous area of habitat is both reduced in area and divided into smaller, more isolated fragments due to activities like logging, agriculture, and urban development. This disrupts ecosystems and decreases the viability of populations.

Regarding the listed options:

  • Mutation: While mutations (genetic changes) are not generally a direct cause of biodiversity loss, they can influence the adaptability and survival of species. However, they are not typically regarded as a major driver of biodiversity loss.
  • Migration: Normal species migrations are natural phenomena and not a direct cause of biodiversity loss. Instead, barriers to migration created by human activities can contribute to biodiversity loss by preventing species from reaching essential habitats for their survival and reproduction.

Therefore, the correct option that lists recognized major causes of biodiversity loss is:

Option D: A, B, and D only (Overexploitation, Co-extinction, and Habitat loss and fragmentation).

Q.26

List of endangered species was released by

(A)
GEAC
(B)
WWF
(C)
FOAM
(D)
IUCN
(D)

Solution

The list of endangered species is officially released by the International Union for Conservation of Nature (IUCN), which is specified as Option D.

The IUCN is an international organization dedicated to natural resource conservation. They are renowned for their comprehensive "Red List of Threatened Species," which assesses the conservation status of plant and animal species worldwide. This Red List is a critical indicator of the health of the world's biodiversity and provides information on the range, population size, habitat and ecology, use and/or trade, threats, and conservation actions that can help inform necessary conservation decisions.

Other options listed such as GEAC (Genetic Engineering Approval Committee), WWF (World Wildlife Fund), and FOAM are not primarily responsible for releasing lists of endangered species globally, although WWF does work extensively in wildlife conservation and might publish reports or statements regarding endangered species based on IUCN's Red List data.

Q.27

Tropical regions show greatest level of species richness because

A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification.

B. Tropical environments are more seasonal.

C. More solar energy is available in tropics.

D. Constant environments promote niche specialization.

E. Tropical environments are constant and predictable.

Choose the correct answer from the options given below.

(A)
A, C, D and E only
(B)
A and B only
(C)
A, B and E only
(D)
A, B and D only
(A)

Solution

The correct answer is:

Option A: A, C, D and E only

  • A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was available for species diversification. This is a major factor contributing to species richness in the tropics. The absence of major geological events like glaciation has allowed for continuous evolution and diversification.

  • C. More solar energy is available in tropics. This leads to higher productivity, supporting a greater number of species.

  • D. Constant environments promote niche specialization. Stable conditions allow species to specialize and adapt to specific niches, leading to greater diversity.

  • E. Tropical environments are constant and predictable. This allows species to evolve specific adaptations to their environment, leading to further specialization and diversification.

Statement B is incorrect: Tropical environments are less seasonal, not more seasonal.

Q.28

Match List I with List II

List - I List - II
A. Robert May I. Species-Area relationship
B. Alexander von Humboldt II. Long term ecosystem experiment using out door plots
C. Paul Ehrlich III. Global species diversity at about 7 million
D. David Tilman IV. Rivet popper hypothesis

Choose the correct answer from the options given below:

(A)
A-II, B-III, C-I, D-IV
(B)
A-III, B-I, C-IV, D-II
(C)
A-I, B-III, C-II, D-IV
(D)
A-III, B-IV, C-II, D-I
(B)

Solution

To match the correct individual with their contribution or hypothesis, let's review each person listed along with the contributions mentioned:

Robert May is best known for his pioneering work in theoretical ecology, particularly in the areas of population dynamics and stability in ecological communities. However, none of the choices directly mention these specific contributions. Among the options, the closest (though indirect) could be his theoretical work that touch upon aspects like species diversity estimations.

Alexander von Humboldt, known for his extensive work in biogeography, made critical observations on the geographic distributions of species. His work best correlates with the "Species-Area relationship," which describes how the number of species increases with the area surveyed.

Paul Ehrlich is famous for his work on population studies and environmental issues facing humanity. His statement about the planet's carrying capacity and potential biodiversity loss is widely known. The "Global species diversity at about 7 million" might closely relate to his biodiversity and population studies, though it's not his primary known work.

David Tilman is well-acclaimed for his experimental work on biodiversity and ecosystem productivity. The "Long term ecosystem experiment using outdoor plots" directly correlates with his experimental approach to studying the relationship between biodiversity and ecosystem functioning using field experiments.

Given these associations:

  • A (Robert May) might best fit with "Global species diversity at about 7 million" (III) though it's a rough fit.
  • B (Alexander von Humboldt) correlating with "Species-Area relationship" (I) is a much clearer connection.
  • C (Paul Ehrlich) and the "Global species diversity at about 7 million" (II) matches if we consider his general scope in biodiversity and population dynamics.
  • D (David Tilman) with "Long term ecosystem experiment using out door plots" (II) is an exact match for his field of work.

Looking at the options provided,

  • Option B: A-III, B-I, C-IV, D-II

This option aligns correctly as per the reasoning.

Therefore, the correct answer is Option B.

Q.29

Match List I with List II

List - I List - II
A. Rhizopus I. Mushroom
B. Ustilago II. Smut fungus
C. Puccinia III. Bread mould
D. Agaricis IV. Rust fungus

Choose the correct answer from the options given below:

(A)
A-III, B-II, C-IV, D-I
(B)
A-I, B-III, C-II, D-IV
(C)
A-III, B-II, C-I, D-IV
(D)
A-IV, B-III, C-II, D-I
(A)

Solution

Let's analyze the matching based on what each item in List I corresponds to in List II:

  • Rhizopus is commonly known as black bread mold, which matches with "Bread mould." Therefore, Rhizopus corresponds to III.
  • Ustilago is a type of smut fungus that affects grains, so it rightfully matches with "Smut fungus." Thus, Ustilago corresponds to II.
  • Puccinia is well-known for causing rust in plants, indicating that it matches with "Rust fungus." This means Puccinia corresponds to IV.
  • Agaricus is the genus that includes various mushrooms, such as the common button mushroom. This matches with "Mushroom," so Agaricus corresponds to I.

Given the matches:

A - Rhizopus corresponds to III, B - Ustilago corresponds to II, C - Puccinia corresponds to IV, D - Agaricus corresponds to I.

Comparing these with the provided options:

  • Option A (A-III, B-II, C-IV, D-I) matches exactly with the analysis above.

Therefore, the correct answer is: Option A.

Q.30

Which one of the following is not a criterion for classification of fungi?

(A)
Morphology of mycelium
(B)
Mode of nutrition
(C)
Mode of spore formation
(D)
Fruiting body
(B)

Solution

The classification of fungi is based on various criteria that broadly include morphology, genetics, and physiological features. Each of the provided options, except one, is a valid criterion for the classification of fungi:

  • Morphology of mycelium: Fungi can have different types of mycelium, which refers to their vegetative structure. Fungi can be classified based on whether they have septate (with cross-walls) or coenocytic (without cross-walls) mycelium. This morphological characteristic is crucial for classification.
  • Mode of spore formation: Spore formation in fungi is a key reproductive strategy and varies significantly among different groups. Spores can be produced sexually or asexually, and the structures involved in spore production are critical for classification. Fungi are often categorized based on whether they form spores inside a sac (ascospores) or on basidia (basidiospores), among others.
  • Fruiting body: The presence and type of fruiting body (such as mushrooms, toadstools, puffballs, etc.) are used in fungi classification. These structures are involved in the production of spores and can be quite distinctive among different fungi groups.

However, the option that is not a criterion for the classification of fungi is:

Mode of nutrition: While fungi are heterotrophic (meaning they obtain their food by absorbing dissolved molecules, typically from decomposing material), this characteristic is generally true across all fungi. They can be saprophytic (decomposers), parasitic (feeding on living organisms), or mutualistic (engaging in mutually beneficial relationships). Despite these differences in their ecological roles or interactions, the mode of nutrition is not typically used as a primary criterion for formal taxonomic classification in fungi. It is more pertinent to ecological or functional groupings rather than taxonomic classification.

Therefore, the correct answer is Option B: Mode of nutrition.

Q.31

Which of the following is an example of actinomorphic flower?

(A)
Datura
(B)
Cassia
(C)
Pisum
(D)
Sesbania
(A)

Solution

The correct answer is:

Option A: Datura Explanation:

An actinomorphic flower is one that can be divided into two equal halves along any plane passing through its center. This is also known as radial symmetry.

  • Datura flowers exhibit radial symmetry, as their petals are arranged in a circular pattern around the center.

The other options are incorrect:

  • Cassia: Zygomorphic (bilateral symmetry)

  • Pisum: Zygomorphic (bilateral symmetry)

  • Sesbania: Zygomorphic (bilateral symmetry)
Q.32

Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

NEET 2024 Biology - Morphology of Flowering Plants Question 14 English

(A)
A
(B)
B
(C)
C
(D)
D
(C)

Solution

The radicle is the part of the seed that will develop into the root when the seed germinates.

In the provided diagram, 'C' represents the radicle.

Q.33

Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a) and (b)

NEET 2024 Biology - Morphology of Flowering Plants Question 13 English

(A)
(a) Epigynous; (b) Hypogynous
(B)
(a) Hypogynous; (b) Epigynous
(C)
(a) Perigynous; (b) Epigynous
(D)
(a) Perigynous; (b) Perigynous
(D)

Solution

If gynoecium is situated in the centre and other parts of the flower are located on the rim of the thalamus almost at the same level, it is called perigynous.

Both diagram shows perigynous condition.

Q.34

Bulliform cells are responsible for

(A)
Inward curling of leaves in monocots.
(B)
Protecting the plant from salt stress.
(C)
Increased photosynthesis in monocots.
(D)
Providing large spaces for storage of sugars.
(A)

Solution

Bulliform cells, which are specialized cells found in the leaves of many monocot plants such as grasses, play a crucial role in responding to environmental stress conditions like water scarcity. Their primary function is associated with the mechanism of leaf folding or rolling during drought or high temperature conditions. This adaptive feature helps in reducing the leaf surface exposed to the air, thereby minimizing water loss through transpiration.

Now, let’s evaluate each option in relation to the role of bulliform cells:

Option A: Inward curling of leaves in monocots.

This option is correct. Bulliform cells are large, thin-walled, and filled with water. When these cells lose water under dry conditions, they collapse, causing the leaf to fold or roll inward. This curling mechanism helps to reduce the exposure of the surface area of the leaf to the harsh environment, thus reducing water loss and protecting the plant during drought.

Option B: Protecting the plant from salt stress.

This option is not correct. While bulliform cells are involved in protecting the plant by reducing transpiration, their role specifically in protecting from salt stress isn't well-documented. Salt stress protection involves other physiological and biochemical responses in plants.

Option C: Increased photosynthesis in monocots.

This is also incorrect. Bulliform cells do not directly influence photosynthesis rates. Their function is mainly related to the mechanical folding of the leaf, which indirectly may influence photosynthetic efficiency under stress conditions but is not their primary role.

Option D: Providing large spaces for storage of sugars.

This option is incorrect. Bulliform cells are not involved in the storage of sugars. Their structure and function are geared towards managing water content for leaf folding mechanisms, rather than nutrient storage.

Therefore, the correct answer is Option A: Inward curling of leaves in monocots.

Q.35

Match List I with List II

List - I List - II
A. Rose I. Twisted aestivation
B. Pea II. Perigynous flower
C. Cotton III. Drupe
D. Mango IV. Marginal placentation

Choose the correct answer from the options given below :

(A)
A-II, B-IV, C-I, D-III
(B)
A-I, B-II, C-III, D-IV
(C)
A-IV, B-III, C-II, D-I
(D)
A-II, B-III, C-IV, D-I
(A)

Solution

Rose have half-inferior ovary, thus it is known as Perigynous flower.

In Pea, the placenta form a ridge along the ventral suture of the ovary and ovules are borne on this ridge forming two rows.

In Cotton, twisted aestivation is present.

In Mango, fruit is drupe.

Q.36

Match List I with List II

List - I
(Types of Stamens)
List - II
(Example)
A. Monoadelphous I. Citrus
B. Diadelphous II. Pea
C. Polyadelphous III. Lily
D. Epiphyllous IV. China-rose

Choose the correct answer from the options given below:

(A)
A-IV, B-II, C-I, D-III
(B)
A-IV, B-I, C-II, D-III
(C)
A-I, B-II, C-IV, D-III
(D)
A-III, B-I, C-IV, D-II
(A)

Solution

The correct answer is: Option A: A-IV, B-II, C-I, D-III

  • Monoadelphous: Stamens united into a single bundle by their filaments. Example: China rose

  • Diadelphous: Stamens united into two bundles by their filaments. Example: Pea

  • Polyadelphous: Stamens united into more than two bundles by their filaments. Example: Citrus

  • Epiphyllous: Stamens arise from the perianth (sepals and petals) rather than from the receptacle. Example: Lily
Q.37

How many molecules of ATP and NADPH are required for every molecule of fixed in the Calvin cycle?

(A)
2 molecules of ATP and 3 molecules of NADPH
(B)
2 molecules of ATP and 2 molecules of NADPH
(C)
3 molecules of ATP and 3 molecules of NADPH
(D)
3 molecules of ATP and 2 molecules of NADPH
(D)

Solution

The Calvin cycle, also known as the Calvin-Benson-Bassham cycle, is the set of chemical reactions that take place in chloroplasts during photosynthesis. The cycle is light-independent because it takes place after the energy has been captured from sunlight. The Calvin cycle uses ATP and NADPH as energy sources, and incorporates into organic molecules, eventually producing glucose.

The cycle consists of three main stages:

  • Carbon fixation
  • Reduction phase
  • Regeneration of the ribulose-1,5-bisphosphate (RuBP)

In the Calvin cycle:

  1. Carbon Fixation: Each molecule is attached to a five-carbon sugar named ribulose-1,5-bisphosphate (RuBP). This reaction is catalyzed by the enzyme ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO). The product of this reaction is a six-carbon intermediate that immediately splits into two molecules of 3-phosphoglycerate (3-PGA).
  2. Reduction Phase: Each 3-PGA is phosphorylated by ATP (consuming 2 ATP molecules total for two 3-PGA molecules) to form 1,3-bisphosphoglycerate. This molecule is then reduced by NADPH (using 2 NADPH molecules in total) to form glyceraldehyde-3-phosphate (G3P). Out of every six G3P formed, one exits the cycle to contribute towards forming glucose, while the rest are recycled to regenerate RuBP.
  3. Regeneration of RuBP: For every three CO2 molecules fixed, five molecules of G3P are used to regenerate three molecules of RuBP, requiring further ATP input (3 more ATP molecules).

Thus, for each incorporated molecule, 3 ATP molecules and 2 NADPH molecules are required:

  • 3 ATP molecules (2 for the reduction of two molecules of 3-PGA into 1,3-bisphosphoglycerate and then one for the regeneration phase of RuBP).
  • 2 NADPH molecules are used to reduce two molecules of 1,3-bisphosphoglycerate to G3P.

Therefore, the correct answer to the question is Option D: 3 molecules of ATP and 2 molecules of NADPH are required for every molecule of fixed in the Calvin cycle.

Q.38

Which of the following are required for the dark reaction of photosynthesis?

A. Light

B. Chlorophyll

C.

D. ATP

E. NADPH

Choose the correct answer from the options given below:

(A)
A, B and C only
(B)
B, C and D only
(C)
C, D and E only
(D)
D and E only
(C)

Solution

The dark reactions of photosynthesis, also known as the Calvin cycle, do not directly require light to proceed and hence are termed "dark reactions." The reactions occur in the stroma of chloroplasts and primarily involve the synthesis of organic molecules from carbon dioxide (). Here's an analysis of the options provided:

  • A. Light: Not required for the dark reactions themselves; these reactions are light-independent.
  • B. Chlorophyll: Chlorophyll is essential for the light-dependent reactions of photosynthesis, where it absorbs light energy and helps convert it into chemical energy. It is not used directly in the dark reactions.
  • C. : Carbon dioxide is a critical substrate in the dark reactions. It is fixed into organic sugars through a series of enzymatic steps in the Calvin cycle.
  • D. ATP: Adenosine triphosphate (ATP) is a vital energy carrier generated in the light reactions. It provides the energy required for the synthesis of glucose from in the dark reactions.
  • E. NADPH: Nicotinamide adenine dinucleotide phosphate (NADPH) is another product of the light reactions and acts as a reducing agent, donating electrons during the reduction of to form glucose in the Calvin cycle.

Given this understanding, the components required for the dark reaction are for carbon fixation, ATP for energy, and NADPH for reducing power. Therefore, the parts necessary from the given list are C, D, and E. So, the correct answer to this question is:

Option C: C, D, and E only

Q.39

Given below are two statements:

Statement I: In plants, some binds to , hence fixation is decreased.

Statement II: In plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are true
(B)
Both Statement I and Statement II are false
(C)
Statement I is true but Statement II is false
(D)
Statement I is false but Statement II is true
(C)

Solution

In plant, some bind to RuBisCO, and hence fixation is decreased. Statement II is incorrect, photorespiration does not occur in plants as they lack RuBisCO in mesophyll. Hence statement I is the only correct option.

Q.40

Which one of the following can be explained on the basis of Mendel's Law of Dominance?

A. Out of one pair of factors one is dominant and the other is recessive.

B. Alleles do not show any expression and both the characters appear as such in F generation.

C. Factors occur in pairs in normal diploid plants.

D. The discrete unit controlling a particular character is called factor.

E. The expression of only one of the parental characters is found in a monohybrid cross.

Choose the correct answer from the options given below:

(A)
A, B and C only
(B)
A, C, D and E only
(C)
B, C and D only
(D)
A, B, C, D and E
(B)

Solution

The correct answer is:

Option B: A, C, D and E only Explanation:

Mendel's Law of Dominance states that in a heterozygote, the dominant allele will mask the expression of the recessive allele. Let's analyze the options:

  • A. Out of one pair of factors one is dominant and the other is recessive: This is the core principle of Mendel's Law of Dominance.

  • C. Factors occur in pairs in normal diploid plants: This is a fundamental concept in genetics, as diploid organisms have two copies of each chromosome, thus two copies of each gene (factors).

  • D. The discrete unit controlling a particular character is called factor: Mendel used the term "factor" to describe what we now know as genes.

  • E. The expression of only one of the parental characters is found in a monohybrid cross: This is a direct consequence of the law of dominance, where the dominant trait masks the expression of the recessive trait in the F1 generation of a monohybrid cross.
Option B is incorrect:

  • B. Alleles do not show any expression and both the characters appear as such in F2 generation: This statement is incorrect. While the recessive allele is not expressed in the F1 generation, it reappears in the F2 generation in a 3:1 ratio (dominant:recessive). This is due to the Law of Segregation, not the Law of Dominance.

Q.41

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

(A)
Only red flowered plants
(B)
Red flowered as well as pink flowered plants
(C)
Only pink flowered plants
(D)
Red, Pink as well as white flowered plants
(B)

Solution

Pink colour flower in snapdragon have genotype

Red flowered snapdragon have genotype RR when they both are crossed

NEET 2024 Biology - Principles of Inheritance and Variation Question 17 English Explanation

So the progeny that we get are red and pink flowered plants only.

Q.42

In a plant, black seed color is dominant over white seed color . In order to find out the genotype of the black seed plant, with which of the following genotype will you cross it?

(A)
(B)
(C)
(D)
(B)

Solution

To determine the genotype of a black seed plant that could either be homozygous dominant () or heterozygous (), you need to perform a test cross. A test cross involves crossing the individual in question with a homozygous recessive individual. In this scenario, that would be a plant with white seed color, or genotype .

A test cross is used because it can reveal whether the black seed plant carries the recessive allele. When crossed with a homozygous recessive () plant:

  • If the black seed plant is homozygous dominant (), all offspring will inherit one allele from the black seed parent and one allele from the white seed parent, resulting in all offspring having black seeds ().
  • If the black seed plant is heterozygous (), there is a 50% chance that an offspring will inherit the allele and a 50% chance of inheriting the allele from the black seed parent. This results in approximately half of the offspring having black seeds () and half having white seeds ().

By observing the seed colors of the offspring, you can determine whether the black seed plant was homozygous dominant or heterozygous. If any white seeds appear among the offspring, the black seed plant must be heterozygous (). If no white seeds appear, the black seed plant is likely homozygous dominant ().

Therefore, the correct option for crossing to determine the genotype of the black seed plant is:
Option B

Q.43

Match List I with List II

List - I List - II
A. Two or more alternative forms of a gene I. Back cross
B. Cross of F progeny with homozygous recessive parent II. Ploidy
C. Cross of F progeny with any of the parents III. Allele
D. Number of chromosome sets in plant IV. Test cross

Choose the correct answer from the options given below:

(A)
A-I, B-II, C-III, D-IV
(B)
A-II, B-I, C-III, D-IV
(C)
A-III, B-IV, C-I, D-II
(D)
A-IV, B-III, C-II, D-I
(C)

Solution

Let's analyze each term in List-I with the definitions presented in List-II:

  • A. Two or more alternative forms of a gene: These are called alleles. Thus, A matches with III 'Allele'.
  • B. Cross of F progeny with homozygous recessive parent: This specific type of cross is known as a test cross, often used to determine the genotype of an individual having dominant phenotype. Therefore, B matches with IV 'Test cross'.
  • C. Cross of F progeny with any of the parents: This is defined as a back cross, which can be used for multiple purposes, including the testing of the parental genes in the offspring. So, C matches with I 'Back cross'.
  • D. Number of chromosome sets in plant: This describes how many sets of chromosomes are present, i.e., the level of ploidy of the organism. Therefore, D matches with II 'Ploidy'.

From the analysis:

  • A matches with III
  • B matches with IV
  • C matches with I
  • D matches with II

Accordingly, the correct answer that matches all the descriptions is:

Option C: A-III, B-IV, C-I, D-II.
Q.44

As per ABO blood grouping system, the blood group of father is , mother is and child is . Their respective genotype can be

A. IBi/IAi/ii

B. IBIB/IAIA/ii

C. iIB/iIA/IAIB

D. IAi/IBi/IAi

E. iIB/iIA/IAIB

Choose the most appropriate answer from the options given below :

(A)
A only
(B)
B only
(C)
C & B only
(D)
D & E only
(A)

Solution

The ABO blood group is determined by alleles IA, IB, and i, which are responsible for producing A, B, and O blood types, respectively. The IA and IB alleles are codominant, meaning both can be expressed if both are present, whereas the i allele is recessive.

Given the blood types in the problem statement:

  • Father's blood group: - Possible genotypes: IBIB or IBi
  • Mother's blood group: - Possible genotypes: IAIA or IAi
  • Child's blood group: - Possible genotype: ii

To find the correct pairing:

The child has an O blood type, meaning their genotype must be ii, indicating they inherited an i allele from each parent. Therefore, both parents must have at least one i allele.

Given this information:

  • Father's Genotype: It must include i since the child inherited i. Thus, the father's genotype could be IBi.
  • Mother's Genotype: It must also include i for the same reason, so the mother's genotype could be IAi.
  • Child's Genotype: It is confirmed as ii.

Matching this analysis with the provided options:

  • Option A: IBi/IAi/ii - This matches the reasoning provided.
  • Option B: IBIB/IAIA/ii - This is incorrect because it suggests that neither parent has a recessive i allele to pass to the child, which is necessary for the child’s blood type O.
  • Option C: iIB/iIA/IAIB - This is incorrect and does not match the required genotypes for the child to inherit ii.
  • Option D: IAi/IBi/IAi - This includes a typo in the children's genotype and misalignment with blood types.
  • Option E: iIB/iIA/IAIB - This is incorrect, mismatches the inheritance mechanism.

So the correct pairing based on the genotypes and blood groups mentioned, along with genetic laws, would be Option "A", i.e., IBi/IAi/ii.

So the answer is: Option A

Q.45

The lactose present in the growth medium of bacteria is transported to the cell by the action of

(A)
Beta-galactosidase
(B)
Acetylase
(C)
Permease
(D)
Polymerase
(C)

Solution

The correct answer is Option C: Permease.

Lactose, a disaccharide sugar composed of glucose and galactose, needs particular mechanisms to be transported into bacterial cells for metabolism. Among the options provided, permease is the protein responsible for this function. Specifically, in the case of bacterial cells such as Escherichia coli, the lactose permease enzyme plays a crucial role.

Lactose permease is encoded by the lacY gene, which is part of the lac operon. The lac operon is a famous example of gene regulation in bacteria. When lactose is present outside the cell, lactose permease facilitates its transport into the cell across the cell membrane. Once inside, lactose can be utilized as a source of energy and carbon.

Once lactose is inside the bacterial cell:

  • It is broken down by the enzyme β-galactosidase into glucose and galactose. This enzyme is encoded by the lacZ gene, which is a different component of the lac operon.

We can rule out the other options because:

  • Beta-galactosidase (Option A) is involved in the hydrolysis of lactose into glucose and galactose but not in its transport.
  • Acetylase (Option B) refers to enzymes involved in the addition of acetyl groups to substrates, unrelated to sugar transport.
  • Polymerase (Option D) are enzymes that synthesize RNA and DNA, thus also unrelated to transporting sugars like lactose.

Thus, to facilitate the transport of lactose across the cell membrane into the bacterial cell, lactose permease (Option C) is required, making it the correct choice.

Q.46

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

(A)
Repressor, Operator gene, Structural gene
(B)
Structural gene, Transposons, Operator gene
(C)
Inducer, Repressor, Structural gene
(D)
Promotor, Structural gene, Terminator
(D)

Solution

A transcription unit in DNA is critical for the process of transcription, wherein a particular segment of DNA is copied into RNA (especially mRNA) by the enzyme RNA polymerase. This unit is composed of sequences that include both coding regions, which are directly transcribed into RNA, and regulatory regions, which ensure that transcription is initiated and terminated at the correct locations on the DNA.

The correct answer is:

Option D: Promotor, Structural gene, Terminator

Here's a detailed explanation of each component:

  • Promoter: The promoter is a sequence in DNA that signals the RNA polymerase to start transcription. It is located at the upstream end (5' end) of the gene. Promoters are essential for transcription initiation and are typically found just before the genes they regulate.
  • Structural gene: This region of the transcription unit is actually expressed or translated into protein (or functional RNA), depending on the kind of gene. These genes contain the functional sequences that are copied during the transcription process.
  • Terminator: The terminator is found at the downstream end (3' end) of the transcription unit and includes sequences that signal the RNA polymerase enzyme to stop transcription. This ensures that the newly synthesized RNA contains only the necessary genetic message.

The other options contain components that do not accurately define the typical structure of a transcription unit:

  • Option A mixes regulatory proteins and DNA regions, which does not accurately represent the structural components of a transcription unit.
  • Option B includes "transposons" which are genetic elements that can move around within the genomes but are not typically part of the transcription unit.
  • Option C again refers to regulatory proteins (inducer and repressor) along with structural genes, confusing the functions of proteins and DNA regions.

Therefore, Option D correctly represents the standard components of a transcription unit in the context of gene transcription in DNA.

Q.47

Which of the following statement is correct regarding the process of replication in E.coli?

(A)
'The DNA dependent DNA polymerase catalyses polymerization in one direction that is '

(B)
The DNA dependent RNA polymerase catalyses polymerization in one direction, that is
(C)
The DNA dependent DNA polymerase catalyses polymerization in 5' 3' as well as direction
(D)
The DNA dependent DNA polymerase catalyses polymerization in 5' 3' direction
(D)

Solution

The correct statement regarding the process of replication in E.coli is found in Option D: "The DNA dependent DNA polymerase catalyses polymerization in 5' 3' direction".

To elaborate, replication in E.coli involves the synthesis of new DNA strands from a DNA template. This synthesis is catalyzed by an enzyme known as DNA polymerase. DNA polymerases are key enzymes that add nucleotides to the growing DNA strand during replication. However, the key characteristic of these enzymes is their directionality. DNA polymerases can only add nucleotides to the 3' end of the DNA strand, thereby synthesizing new DNA in the direction of 5' 3'.

This directional limitation is due to the structure of deoxyribonucleotide triphosphates (dNTPs) that are used as substrates by the enzyme. Each dNTP has a 5' phosphate group, a 3' hydroxyl group, and a nitrogenous base. The formation of DNA strands occurs via the formation of phosphodiester bonds between the 3' hydroxyl group of one nucleotide and the phosphate group at the 5' position of the next nucleotide. Therefore, nucleotides can only be added to the 3' end of the growing strand.

The other options are incorrect for the following reasons:

  • Option A incorrectly states the direction of synthesis as , which is impossible with the mechanics of DNA polymerases.
  • Option B refers to DNA dependent RNA polymerase. This enzyme is indeed involved in transcription (synthesizing RNA from DNA), not replication, and synthesizes RNA in the direction.
  • Option C incorrectly states that DNA polymerase can synthesize in both directions, which contradicts the inherent directional nature of this enzyme.

Therefore, understanding the precise enzyme mechanics and functionality helps in recognizing that Option D is the correct description of how DNA dependent DNA polymerase facilitates DNA replication in E.coli.

Q.48

Match List I with List II

List - I List - II
A. Frederick Griffith I. Genetic code
B. Francois Jacob & Jacque Monod II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana III. Tranformation
D. Meselson & Stahl IV. Lac operon

Choose the correct answer from the options given below:

(A)
A-III, B-II, C-I, D-IV
(B)
A-III, B-IV, C-I, D-II
(C)
A-II, B-III, C-IV, D-I
(D)
A-IV, B-II, C-II, D-III
(B)

Solution

To solve this matching question, let's discuss each scientist(s) and their contribution:

A. Frederick Griffith: Known for discovering the "transforming principle," which showed that a substance from dead bacteria could genetically transform living bacteria. This process is called transformation. The correct match for Frederick Griffith is III. Transformation.

B. Francois Jacob & Jacques Monod: They are famous for their work on the lac operon, a set of genes involved in lactose metabolism in bacteria. Their study elucidated how genes are regulated and expressed in cells. The correct match for Francois Jacob and Jacques Monod is IV. Lac operon.

C. Har Gobind Khorana: Known for his research on the genetic code and its role in protein synthesis. Khorana was one of the scientists who elucidated how the sequence of nucleotides in nucleic acids is translated into protein sequences. The correct match for Har Gobind Khorana is I. Genetic code.

D. Meselson & Stahl: Famous for their experiment confirming the semi-conservative mechanism of DNA replication, where each new DNA molecule consists of one old strand and one newly synthesized strand. The correct match for Meselson and Stahl is II. Semi-conservative mode of DNA replication.

Comparing this information with the options provided:

  • Option A: A-III, B-II, C-I, D-IV (Incorrect: B does not match II)
  • Option B: A-III, B-IV, C-I, D-II (Correct: All matches are accurate)
  • Option C: A-II, B-III, C-IV, D-I (Incorrect: A, B, C, and D do not match correctly)
  • Option D: A-IV, B-II, C-II, D-III (Incorrect: A, C, and D do not match correctly)

Therefore, the correct answer is Option B.

Q.49

Match List I with List II :

List - I List - II
A. Down's syndrome I. 11 chromosome
B. -thalassemia II. 'X' chromosome
C. -thalassemia III. 21 chromosome
D. Klinefelter's syndrome IV. 16 chromosome

Choose the correct answer from the options given below :

(A)
A-I, B-II, C-III, D-IV
(B)
A-II, B-III, C-IV, D-I
(C)
A-III, B-IV, C-I, D-II
(D)
A-IV, B-I, C-II, D-III
(C)

Solution

To correctly match List I with List II concerning medical conditions and their associated chromosomes, it's essential to have some understanding of genetics and chromosome abnormalities related with each condition. Here's the correct matching based on that information:

  • Down's syndrome: This genetic disorder is characterized by an extra copy (trisomy) of the 21 chromosome, which makes it associated with 21 chromosome (III).
  • -thalassemia: This condition is related to a mutation or deletion in the alpha globin genes located on the 16 chromosome (IV).
  • -thalassemia: This is a blood disorder caused due to mutations in the beta globin gene found on the 11 chromosome (I).
  • Klinefelter's syndrome: This syndrome arises from the presence of an extra X chromosome in males (usually XXY), so it is related to abnormality in the 'X' chromosome (II).

Given these matches:

  • A - III
  • B - IV
  • C - I
  • D - II

The correct option based on the details above is:

Option C: A-III, B-IV, C-I, D-II

Q.50

Which one is the correct product of DNA dependent RNA polymerase to the given template?

3'TACATGGCAAATATCCATTCA5'

(A)
5'AUGUACCGUUUAUAGGUAAGU3'
(B)
5'AUGUAAAGUUUAUAGGUAAGU3'
(C)
5'AUGUACCGUUUAUAGGGAAGU3'
(D)
5'ATGTACCGTTTATAGGTAAGT3'
(A)

Solution

DNA-dependent RNA polymerase is an enzyme responsible for transcribing DNA into RNA. During transcription, the RNA polymerase reads the template strand of DNA and synthesizes a complementary RNA strand. A key point in this process is that RNA polymerase builds RNA by replacing thymine (T) with uracil (U).

The provided DNA template is:

3'TACATGGCAAATATCCATTCA5'

To find the correct RNA sequence, we need to identify the complementary base for each base in the template strand while considering RNA bases. Remember, in RNA:

  • A (Adenine) pairs with U (Uracil)
  • T (Thymine) pairs with A (Adenine)
  • C (Cytosine) pairs with G (Guanine)
  • G (Guanine) pairs with C (Cytosine)

The complementary RNA sequence to the DNA template is generated as follows:

  • 3'T --> 5'A
  • 3'A --> 5'U
  • 3'C --> 5'G
  • 3'G --> 5'C
  • 3'T --> 5'A
  • 3'A --> 5'U
  • 3'T --> 5'A
  • 3'G --> 5'C
  • 3'G --> 5'C
  • 3'C --> 5'G
  • 3'A --> 5'U
  • 3'A --> 5'U
  • 3'T --> 5'A
  • 3'A --> 5'U
  • 3'T --> 5'A
  • 3'C --> 5'G
  • 3'C --> 5'G
  • 3'A --> 5'U
  • 3'T --> 5'A
  • 3'T --> 5'A
  • 3'C --> 5'G'

This constructs the RNA sequence:

5'AUGUACCGUUUAUAGGUAAGU3'

Thus, Option A correctly represents the RNA sequence transcribed by DNA-dependent RNA polymerase from the given DNA template:

Option A: 5'AUGUACCGUUUAUAGGUAAGU3'

Q.51

Match List I with List II:

List - I List - II
A. RNA polymerase III I. snRNPs
B. Termination of transcription II. Promotor
C. Splicing of Exons III. Rho factor
D. TATA box IV. SnRNAs, tRNA

Choose the correct answer from the options given below :

(A)
A-II, B-IV, C-I, D-III
(B)
A-III, B-II, C-IV, D-I
(C)
A-III, B-IV, C-I, D-II
(D)
A-IV, B-III, C-I, D-II
(D)

Solution

The goal is to correctly match the terms in List I with the descriptions in List II. Let's analyze and match each term from List I with its appropriate partner in List II:

List I:

  • A. RNA polymerase III: This enzyme is primarily responsible for transcribing DNA to synthesize tRNA, 5S rRNA, and other small RNAs.
  • B. Termination of transcription: In prokaryotes, specific termination factors such as the Rho factor are involved in stopping transcription. In eukaryotes, different mechanisms and sequences are used.
  • C. Splicing of Exons: The process involving the removal of introns and joining of exons during mRNA processing. Small nuclear ribonucleoproteins (snRNPs) are critical components in this process.
  • D. TATA box: A DNA sequence within the promoter region, which is crucial for forming the transcription initiation complex.

List II:

  • I. snRNPs: Small nuclear ribonucleoproteins involved in mRNA splicing.
  • II. Promoter: A region of DNA that initiates transcription of a particular gene, typically containing sequences like the TATA box.
  • III. Rho factor: A protein essential for terminating transcription in prokaryotes.
  • IV. SnRNAs, tRNA: Molecules transcribed primarily by RNA polymerase III.

Matching these descriptions:

  • A (RNA polymerase III) matches with IV (SnRNAs, tRNA).
  • B (Termination of transcription) matches with III (Rho factor).
  • C (Splicing of Exons) matches with I (snRNPs).
  • D (TATA box) matches with II (Promoter).

Therefore, the correct matches according to options listed are:

Option D: A-IV, B-III, C-I, D-II

Q.52

The capacity to generate a whole plant from any cell of the plant is called:

(A)
Totipotency
(B)
Micropropagation
(C)
Differentiation
(D)
Somatic hybridization
(A)

Solution

Totipotency is defined as the capacity to generate a whole plant from any cell of the plant.

Q.53

Given below are two statements:

Statement I : Bt toxins are insect group specific and coded by a gene cry IAc.

Statement II : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect the inactive protoxin gets converted into active form due to acidic of the insect gut.

In the light of the above statements, choose the correct answer from the options given below:

(A)
Both Statement I and Statement II are true
(B)
Both Statement I and Statement II are false
(C)
Statement I is true but Statement II is false
(D)
Statement I is false but Statement II is true
(C)

Solution

The correct answer is option (3) as specific Bt toxin genes were isolated from Bacillus thuringiensis and incorporated into the several crop plants such as cotton. The choice of genes depends upon the crop and the targeted pest as most Bt toxins are insect-group specific. The toxin is coded by a gene named cry. There are a number of them, for example, the proteins encoded by the genes cry IAc and cry IIAb control the cotton bollworms, that of cry IAb controls corn borer.

Q.54

What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?

A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.

B. It may get integrated into the genome of the recipient.

C. It may multiply and be inherited along with the host DNA.

D. The alien piece of DNA is not an integral part of chromosome.

E. It shows ability to replicate.

Choose the correct answer from the options given below:

(A)
A and B only
(B)
D and E only
(C)
B and C only
(D)
A and E only
(C)

Solution

When a piece of DNA carrying a gene of interest is transferred into an alien organism, its fate depends on several factors, including the mechanisms it has for replication, integration, and inheritance. Here is an analysis of each statement provided:

A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
This is incorrect unless the DNA contains an origin of replication that is compatible with the host cell's replication machinery.

B. It may get integrated into the genome of the recipient.
This is a likely scenario if the DNA has sequences that facilitate recombination with the host genome or if the host has natural mechanisms of DNA integration such as those observed in bacteria with transformation capabilities, or other eukaryotic organisms with similar processes.

C. It may multiply and be inherited along with the host DNA.
This statement can be true if the introduced DNA is replicated along with the host DNA, possibly through integration into the host genome or existence in the form of an episome that replicates independently yet synchronously with the host DNA.

D. The alien piece of DNA is not an integral part of chromosome.
This statement is generally accurate before integration. The introduced DNA, before integration, exists extrachromosomally and thus is not part of any chromosome, unless mechanisms are present for its integration into the host genome.

E. It shows ability to replicate.
This statement depends on specific sequences in the DNA, such as the origin of replication compatible with the host cell's machinery, mentioned in statement A. Without these, it will not replicate independently.

Given these explanations, the most accurate answer that describes the fate of the DNA in the recipient organism is:

Option C: B and C only
'B' is correct as the DNA may integrate into the host genome, and 'C' is correct as the DNA might also multiply if replicated in sync with the host organism's DNA, particularly if it integrates or exists as an episome compatible with the host's cellular machinery.

Q.55

Which of the following are fused in somatic hybridization involving two varieties of plants?

(A)
Callus
(B)
Somatic embryos
(C)
Protoplasts
(D)
Pollens
(C)

Solution

In somatic hybridization, the fusion of protoplasts from different plant varieties or species is a key technique. Protoplasts are plant cells that have had their cell walls enzymatically removed, exposing the cell membrane. This condition allows for the direct fusion of cellular contents including the nucleus and cytoplasm from different cells, facilitating recombination and the formation of a hybrid cell. The process of fusion typically involves techniques such as electrofusion or chemical treatments to encourage the protoplasts to merge.

Looking at the options provided:

  • Option A: Callus – This is not correct. A callus is a mass of unorganized plant cells that are generally not involved in fusion during somatic hybridization but are rather a product of the culture of somatic cells.
  • Option B: Somatic embryos – These are not the direct subjects of fusion in somatic hybridization. Somatic embryos can develop from hybrid cells, but they themselves are not fused; they are derived from somatic cells under appropriate conditions.
  • Option C: Protoplasts – This is correct. Protoplasts are indeed what are fused in somatic hybridization to combine the genetic material from two different plants or varieties.
  • Option D: Pollens – These do not fuse in somatic hybridization. Pollen fusion is more relevant to sexual reproduction and breeding, not somatic cell procedures.

Therefore, the correct answer is Option C: Protoplasts.

Q.56

Match List I with List II

List - I List - II
A. -I antitrypsin I. Cotton bollworm
B. Cry IAb II. ADA deficiency
C. Cry IAc III. Emphysema
D. Enzyme replacement therapy IV. Corn borer

Choose the correct answer form the options given below:

(A)
A-II, B-I, C-IV, D-III
(B)
A-III, B-I, C-II, D-IV
(C)
A-III, B-IV, C-I, D-II
(D)
A-II, B-IV, C-I, D-III
(C)

Solution

To provide the correct answer, let's evaluate each option by matching the items from List I with their corresponding descriptions from List II:

  • -I antitrypsin - This is a protease inhibitor and its deficiency leads to emphysema due to the degradation of the lung tissue. Therefore, -I antitrypsin corresponds to Emphysema (III).
  • Cry IAb - Part of a family of proteins from Bacillus thuringiensis used as a biological pesticide. Cry IAb is notably effective against certain types of Lepidoptera, including the European Corn Borer (IV).
  • Cry IAc - This is also a protein from Bacillus thuringiensis and is notably effective against Cotton Bollworm (I).
  • Enzyme replacement therapy - Typically used for treating deficiencies in certain enzymes; one prevalent example is Adenosine Deaminase (ADA) deficiency, which leads to immune deficiencies (II).

Let's match these back to the original options provided:

  • A-III ( -I antitrypsin matches with Emphysema)
  • B-IV (Cry IAb matches with Corn Borer)
  • C-I (Cry IAc matches with Cotton Bollworm)
  • D-II (Enzyme replacement therapy matches with ADA deficiency)

Based on these matches, the correct option would be:

Option C: A-III, B-IV, C-I, D-II

Q.57

Which of the following statements is incorrect?

(A)
A bio-reactor provides optimal growth conditions for achieving the desired product
(B)
Most commonly used bio-reactors are of stirring type
(C)
Bio-reactors are used to produce small scale bacterial cultures
(D)
Bio-reactors have an agitator system, an oxygen delivery system and foam control system
(C)

Solution

The incorrect statement among the provided options is:

Option C: Bio-reactors are used to produce small scale bacterial cultures.

Explanation:

Bio-reactors, also known as fermenters, are primarily utilized for scaling up microbial processes to industrial scales. They are designed to support the growth of a high density of cells and microbes under controlled conditions to produce large volumes of biochemical products such as enzymes, pharmaceuticals, and other biologically active compounds. While bio-reactors can technically be used for small-scale laboratory experiments, their main application and design focus is on large-scale production.

Other Options:

Option A: This statement is correct. Bio-reactors are specifically designed to provide optimal conditions such as temperature, pH, oxygen supply, and nutrients for the growth of microorganisms or cells, which helps in achieving a higher yield of the desired product.

Option B: This statement is also true. The most common type of bio-reactors used in industrial processes are of the stirred type, which have mechanical agitators to evenly distribute nutrients and maintain uniform conditions within the tank.

Option D: True, bio-reactors often include several essential systems: an agitator system for mixing, an oxygen delivery system to provide sufficient respiration for aerobic organisms, and a foam control system to prevent the formation of excessive foam, which could interfere with the operation of the reactor.

Thus, the incorrect statement about the typical scale and focus of bio-reactor use is Option C.

Q.58

The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’ genes :

NEET 2024 Biology - Biotechnology and It's Applications Question 6 English

(A)
The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of Plasmid.
(B)
The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved in the replication of Plasmid.
(C)
The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
(D)
Gene ’X’ is responsible for recognitions sites and ‘Y’ is responsible for antibiotic resistance.
(B)

Solution

Correct answer is option (2), because

'X' in the given diagram is ori while 'Y' is rop.

'X' which is ori is responsible for controlling the copy number of the linked DNA and 'Y' which is rop codes for protein involved in the replication of plasmid.

Options (1), (3) and (4) are incorrect as 'X' and 'Y' are not related to these functions.

Q.59

The equation of Verhulst-Pearl logistic growth is . From this equation, indicates:

(A)
Intrinsic rate of natural increase
(B)
Biotic potential
(C)
Carrying capacity
(D)
Population density
(C)

Solution

The Verhulst-Pearl logistic growth equation you've presented is a fundamental model used to describe how populations grow under limited resource conditions. This model is sensitive to both the variables and coefficients it incorporates:

Here:

  • represents the population size at time .
  • is the intrinsic rate of natural increase, indicating the rate at which the population grows per individual when resources are not limiting.
  • represents the carrying capacity of the environment.

In the context of this equation:

  • The term is a fraction that reduces the effective growth rate as the population size approaches the carrying capacity . This term essentially represents the remaining proportion of resources available as the population grows larger.

Based on this understanding:

  • Option A: "Intrinsic rate of natural increase" – Incorrect, this is represented by in the equation.
  • Option B: "Biotic potential" – Incorrect, biotic potential generally refers to the maximum reproductive capacity of an organism under optimal conditions, often considered similar to but not specifically the same as .
  • Option C: "Carrying capacity" – Correct, as in the equation is specifically describing the carrying capacity, which is the maximum population size that the environment can sustain indefinitely given the food, habitat, water, and other necessities available in the environment.
  • Option D: "Population density" – Incorrect, while relates directly to population density at any time, is about the upper limit of that density sustainable by the environment.

Therefore, Option C is the correct answer. The variable in the Verhulst-Pearl logistic growth equation indeed stands for the carrying capacity.

Q.60

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

(A)
Genetic recombination
(B)
Genetic drift
(C)
Gene migration
(D)
Constant gene pool
(D)

Solution

The Hardy-Weinberg equilibrium is a principle that predicts how gene frequencies in a population's gene pool will remain constant over time, assuming certain conditions are met. These conditions include no mutation, random mating, no gene flow, infinite population size, and no selection. If any of these conditions are violated, then the Hardy-Weinberg equilibrium can be disrupted.

Option A: Genetic recombination

Genetic recombination refers to the process by which genetic material is rearranged or exchanged between different chromosomes or between different regions within the same chromosome. It can introduce new gene combinations into a population but does not itself change allele frequencies unless it is associated with differential survival or reproduction. Thus, genetic recombination alone does not disrupt Hardy-Weinberg equilibrium.

Option B: Genetic drift

Genetic drift is a stochastic effect that occurs due to the random sampling of alleles when gametes are formed, and it can greatly influence the allele frequencies in small populations. It can cause random changes in allele frequencies over time, thereby affecting the Hardy-Weinberg equilibrium.

Option C: Gene migration

Gene migration or gene flow involves the transfer of alleles from one population to another. When individuals move between populations, they can introduce new alleles to the gene pool, or change the relative frequencies of existing alleles, both of which disturb the Hardy-Weinberg equilibrium.

Option D: Constant gene pool

A constant gene pool implies no change in allele frequencies over time, which is in line with the Hardy-Weinberg principle. Therefore, by definition, this factor does not affect or disrupt the Hardy-Weinberg equilibrium.

Based on these explanations, Option D: Constant gene pool is the factor that will not affect the Hardy-Weinberg equilibrium as it represents the ideal condition where allele frequencies remain consistent, which is central to the Hardy-Weinberg principle.

Q.61

Given below are two statements:

Statement I: Gause's competitive exclusion principle states that two closely related species competing for different resources cannot exist indefinitely.

Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting.

In the light of the above statements, choose the correct answer from the options given below :

(A)
Both Statement I and Statement II are true.
(B)
Both Statement I and Statement II are false.
(C)
Statement I is true but Statement II is false.
(D)
Statement I is false but Statement II is true.
(D)

Solution

Let's analyze the two statements given and compare them with Gause's competitive exclusion principle.

Statement I: "Gause's competitive exclusion principle states that two closely related species competing for different resources cannot coexist indefinitely." This statement is incorrect. Gause's principle actually states that two species competing for the same limited resource cannot coexist indefinitely. If the resources are different, the principle does not necessarily apply because the species are not directly competing against each other for the same needs. Therefore, the correct phrasing should refer to species competing for the same resource.

Statement II: "According to Gause's principle, during competition, the inferior will be eliminated. This may be true if resources are limiting." This statement accurately describes a possible outcome according to Gause's competitive exclusion principle. The principle suggests that in a scenario where two species compete for the same limited resource, one species will often outcompete the other, leading to the decline or possible extinction of the less competitive species.

From the analysis above:

Statement I is false because it incorrectly states that species compete for different resources under Gause's principle.

Statement II is true as it correctly highlights the eventual elimination of one species due to competition over limited resources.

Therefore, the correct answer is:

Option D: Statement I is false but Statement II is true.

Q.62

Read the following statements and choose the set of correct statements:

In the members of Phaeophyceae,

A. Asexual reproduction occurs usually by biflagellate zoospores.

B. Sexual reproduction is by oogamous method only.

C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.

D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.

E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.

Choose the correct answer from the options given below:

(A)
A, B, C and D only
(B)
B, C, D and E only
(C)
A, C, D and E only
(D)
A, B, C and E only
(C)

Solution

Let's analyze each statement:

Statement A: Asexual reproduction occurs usually by biflagellate zoospores. - This statement is true for Phaeophyceae (brown algae). Asexual reproduction in these algae generally involves the release of biflagellate zoospores that swim away and eventually settle and grow into new individuals.

Statement B: Sexual reproduction is by oogamous method only. - This statement is partially true. While sexual reproduction in Phaeophyceae often is oogamous (involving a large non-motile egg and a smaller motile sperm), there are instances where isogamy (both gametes are motile and similar in size) occurs, though it is less common. Thus, the statement might be misleading as it implies that oogamy is the only method of sexual reproduction.

Statement C: Stored food is in the form of carbohydrates which is either mannitol or laminarin. - This statement is correct. In brown algae, the primary carbohydrates stored are mannitol and laminarin. These serve as crucial energy storage compounds.

Statement D: The major pigments found are chlorophyll a, c and carotenoids and xanthophyll. - This statement is true. The brown algae have chlorophyll a, c, various carotenoids, and xanthophylls like fucoxanthin which give them their distinctive brown color.

Statement E: Vegetative cells have a cellulosic wall, usually covered on the outside by a gelatinous coating of algin. - This statement is true. Brown algae have cell walls made of cellulose and are often covered by a layer of alginates, which can form a gelatinous coating. This helps in providing structural support and protection against dessication and mechanical damage.

Given these analyses:

  • A, C, D, and E are true.
  • B is not exclusively true as it suggests that oogamy is the only form of sexual reproduction.

Thus, the correct option is:

Option C: A, C, D and E only

Q.63

Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin

(A)
promotes apical dominance.
(B)
promotes abscission of mature leaves only.
(C)
does not affect mature monocotyledonous plants.
(D)
can help in cell division in grasses, to produce growth.
(C)

Solution

Auxin is a plant growth hormone primarily known for its role in stimulating plant growth by facilitating elongation of cells within shoots. Its effect varies depending on the plant species and its developmental stage. The given options can be assessed to understand why grass remains undamaged in lawns treated with auxin for weed control.

Option A: promotes apical dominance.
Apical dominance refers to the phenomenon where the main, central stem of the plant grows more dominantly than the side stems due to the concentration of auxin in the apex. This is not relevant to the selective action of auxin on weeds versus grass, because while it might affect growth patterns, it doesn’t relate directly to why weeds are eliminated and grass is not.

Option B: promotes abscission of mature leaves only.
Abscission is the process where parts of a plant, such as leaves or fruit, are shed. Auxin helps delay abscission by inhibiting the process. Thus, promoting abscission does not align with the characteristic actions of auxin. Additionally, this mechanism would not be selective for weeds over grass.

Option C: does not affect mature monocotyledonous plants.
Grasses are monocotyledonous plants, characterized by having one seed leaf, parallel leaf veins, and vascular bundles scattered in stem sections. It is known that the structure and growth patterns of monocots differ sufficiently from dicots; hence, many dicot-specific herbicides (including those based on auxin-like substances) do not affect monocots. Therefore, this option provides a plausible explanation why grass, a monocot, remains unaffected by a treatment intended for dicot weeds.

Option D: can help in cell division in grasses, to produce growth.
While auxin does promote cell division and growth in plants, this is a generalized action and does not explain why it would selectively not harm grass when used as a weed killer in lawns.

Based on the analysis above, the correct answer is Option C: does not affect mature monocotyledonous plants. This option directly addresses the differential effect of auxin on monocots versus dicots, aligning with the observed outcome that grass remains undamaged while dicot weeds are targeted.

Q.64

Formation of interfascicular cambium from fully developed parenchyma cells is an example for

(A)
Differentiation
(B)
Redifferentiation
(C)
Dedifferentiation
(D)
Maturation
(C)

Solution

The process involved in the formation of interfascicular cambium from fully developed parenchyma cells is known as "dedifferentiation." This is because dedifferentiation refers to the phenomenon where mature, specialized cells revert to a more primitive, less specialized state. In plants, certain mature cells, such as parenchyma cells, can lose their specialized characteristics and revert to meristematic activity. This newly formed meristematic tissue can then differentiate into specialized tissues once again, in this case, forming interfascicular cambium.

In contrast, differentiation (Option A) is the process where cells develop from a less specialized form to a more specialized form. Redifferentiation (Option B) refers to the process where dedifferentiated cells become specialized again, but this is a subsequent step following dedifferentiation. Maturation (Option D) refers to the final stages of cell and tissue specialization, not the regression to a less developed state.

Therefore, the correct answer to the query is:

Option C - Dedifferentiation
Q.65

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?

(A)
Auxin
(B)
Gibberellin
(C)
Cytokinin
(D)
Abscisic acid
(B)

Solution

The correct answer to the question is Option B, Gibberellin. Gibberellins (GAs) are a group of plant hormones that play a crucial role in regulating various aspects of plant growth and development. One of the notable effects of gibberellins is their ability to promote stem elongation by stimulating cell division and elongation.

In the case of sugarcane, a crop that is valued for its stem (from which sucrose is extracted), applying gibberellin can increase the length of the stem, thereby potentially increasing the yield of the crop. This increase in stem length due to gibberellin application is primarily because gibberellins overcome the inhibitory effects of other hormones that suppress growth; they stimulate the cells in the stems to grow larger and divide more frequently.

While Auxin (Option A) and Cytokinins (Option C) also influence plant growth and have their specific uses, such as rooting and promoting cell division, respectively, they do not primarily target stem elongation to the extent gibberellins do. Abscisic acid (Option D) is generally involved in stress responses and the inhibition of growth, making it unsuitable for promoting stem elongation.

Therefore, to specifically enhance stem length and yield in sugarcane, gibberellins are the most effective plant growth regulators among the options given.

Q.66

In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is , what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

(A)
(B)
(C)
(D)
(C)

Solution

NPP at first trophic level would be the GPP for second trophic level. NPP at second trophic level would be GPP for third trophic level. Therefore, would be GPP at second trophic level and i.e., energy would be GPP at third trophic level.

Q.67

Which of the following are Autoimmune disorders?

A. Myasthenia gravis

B. Rheumatoid arthritis

C. Gout

D. Muscular dystrophy

E. Systemic Lupus Erythematosus (SLE)

Choose the most appropriate answer from the options given below:

(A)
A, B & D only
(B)
A, B & E only
(C)
B, C & E only
(D)
C, D & E only
(B)

Solution

Autoimmune disorders are conditions in which the immune system mistakenly attacks the body's own tissues. Analysis of the given diseases in the context of autoimmune disorders includes:

  • Myasthenia gravis: This is an autoimmune disorder where antibodies interfere with the communication between nerves and muscles, leading to muscle weakness.
  • Rheumatoid arthritis: Another autoimmune disease where the immune system mistakenly attacks the lining of the joints, causing inflammation and potentially leading to joint deformity.
  • Gout: This is not an autoimmune disease; it's a form of arthritis caused by excess uric acid in the bloodstream, resulting in the formation of crystals in joints, not by immune system activity attacking body tissues.
  • Muscular dystrophy: This refers to a group of genetic diseases characterized by progressive weakness and loss of muscle mass, not caused by an autoimmune response.
  • Systemic Lupus Erythematosus (SLE): It is an autoimmune disease in which the immune system attacks various body systems including skin, joints, and organs like kidneys and heart.

With this analysis, the correct diseases identified as autoimmune disorders are Myasthenia gravis, Rheumatoid arthritis, and Systemic Lupus Erythematosus (SLE). Therefore, among the provided options, the correct answer is:

Option B: A, B & E only

Q.68

Match List I with List II:

List - I List - II
A. Typhoid I. Fungus
B. Leishmaniasis II. Nematode
C. Ringworm III. Protozoa
D. Filariasis IV. Bacteria

Choose the correct answer from the options given below:

(A)
A-I, B-III, C-II, D-IV
(B)
A-IV, B-III, C-I, D-II
(C)
A-III, B-I, C-IV, D-II
(D)
A-II, B-IV, C-III, D-I
(B)

Solution

To correctly match List I (Diseases) with List II (Pathogen Types), we need to understand the causative agents for each disease listed in List I.

Details for each disease:

  • Typhoid: This is a bacterial infection caused by Salmonella typhi. Hence, it matches with "Bacteria".
  • Leishmaniasis: This disease is caused by parasitic protozoans of the genus Leishmania. Therefore, it corresponds to "Protozoa".
  • Ringworm: Despite its name, ringworm is not caused by a worm. It’s a fungal infection on the skin, caused by various types of fungi. So, Ringworm should be associated with "Fungus".
  • Filariasis: Also known as lymphatic filariasis, this condition is caused by infection with parasites classified as nematodes (roundworms) of the family Filarioidea. Thus, it matches with "Nematode".

With this understanding:

  • A should be paired with IV (Bacteria).
  • B should be paired with III (Protozoa).
  • C should be paired with I (Fungus).
  • D should be paired with II (Nematode).

Corresponding to the options provided:

  • Option A: A-I, B-III, C-II, D-IV - Incorrect
  • Option B: A-IV, B-III, C-I, D-II - Correct!
  • Option C: A-III, B-I, C-IV, D-II - Incorrect
  • Option D: A-II, B-IV, C-III, D-I - Incorrect

Therefore, the correct answer is Option B: A-IV, B-III, C-I, D-II.

Q.69

Match List I with List II:

List - I List - II
A. Cocaine I. Effective sedative in surgery
B. Heroin II. Cannabis sativa
C. Morphine III. Erythroxylum
D. Marijuana IV. Papaver somniferum

Choose the correct answer from the options given below:

(A)
A-IV, B-III, C-I, D-II
(B)
A-I, B-III, C-II, D-IV
(C)
A-II, B-I, C-III, D-IV
(D)
A-III, B-IV, C-I, D-II
(D)

Solution

To solve this matching problem, we need to identify which plant or application each substance in List I is correctly associated with in List II.

List I (Substances) and List II (their sources or uses):

  • Cocaine - Cocaine is derived from the coca plant, known scientifically as Erythroxylum. This matches with III in List II.
  • Heroin - Heroin is derived from the opium poppy, Papaver somniferum. This corresponds to IV in List II.
  • Morphine - Like heroin, Morphine is also derived from the opium poppy, Papaver somniferum. However, morphine is also directly associated with its use as a sedative in surgery, making I a valid association for its usage.
  • Marijuana - Marijuana is derived from Cannabis sativa, which corresponds to II in List II.

With this information:

  • A (Cocaine) matches with III (from Erythroxylum).
  • B (Heroin) matches with IV (Papaver somniferum).
  • C (Morphine) as an effective sedative in surgery matches with I.
  • D (Marijuana) matches with II (Cannabis sativa).

The correct matching based on the provided options is:

Option D: A-III, B-IV, C-I, D-II

This option correctly matches the substance with their respective sources or primary uses.

Q.70

Match List I with List II :

List - I List - II
A. Common cold I. Plasmodium
B. Haemozoin II. Typhoid
C. Widal test III. Rhinoviruses
D. Allergy IV. Dust mites

Choose the correct answer from the options given below :

(A)
A-III, B-IV, C-III, D-I
(B)
A-I, B-III, C-II, D-IV
(C)
A-III, B-I, C-II, D-IV
(D)
A-IV, B-II, C-III, D-I
(C)

Solution

To correctly match the items in List I with List II, we need to understand each term and its relationship:

  • Common Cold is primarily caused by Rhinoviruses. Hence, A is linked with III.
  • Haemozoin is a byproduct of the digestion of blood by parasites such as Plasmodium (which causes malaria). Therefore, B corresponds with I.
  • Widal test is a diagnostic test for Typhoid fever, caused by the bacterium Salmonella Typhi. Thus, C matches with II.
  • Allergy can be triggered by many allergens, including Dust Mites, which are a common cause of respiratory and dermatological allergies. Consequently, D aligns with IV.

Based on this, the matching should be:

A-III, B-I, C-II, D-IV

Therefore, the correct answer is:

Option C: A-III, B-I, C-II, D-IV

Q.71

Given below are two statements :

Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Statement II : Both bone marrow and thymus provide micro environments for the development and maturation of T-lymphocytes.

In the light of above statements, choose the most appropriate answer from the options given below

(A)
Both Statement I and Statement II are correct.
(B)
Both Statement I and Statement II are incorrect.
(C)
Statement I is correct but Statement II is incorrect.
(D)
Statement I is incorrect but Statement II is correct.
(A)

Solution

The correct answer is option no. (A) as both statements I and II are correct.

In humans, the bone marrow is the main lymphoid organ where all blood cells including lymphocytes are produced.

Both bone-marrow and thymus provide micro-environments for the development and maturation of T-lymphocytes.

Options (B), (C) and (D) are incorrect.

Q.72

Following are the stages of pathway for conduction of an action potential through the heart

A. AV bundle

B. Purkinje fibres

C. AV node

D. Bundle branches

E. SA node

Choose the correct sequence of pathway from the options given below

(A)
E-C-A-D-B
(B)
A-E-C-B-D
(C)
B-D-E-C-A
(D)
E-A-D-B-C
(A)

Solution

The electrical pathway for the conduction of an action potential through the heart is a precisely coordinated process, essential for maintaining the heart's rhythmic beating. To understand this conduction pathway, it’s important to know the roles of the specific components involved:

  • SA node (Sinoatrial node): Often referred to as the pacemaker of the heart. It initiates the electrical impulse, causing the atria to contract.
  • AV node (Atrioventricular node): Receives the impulse from the SA node and provides a slight delay, allowing the ventricles time to fill with blood before they contract.
  • AV bundle (Bundle of His): Transfers the electrical impulse from the AV node to the bundle branches.
  • Bundle branches: Conducts the impulses through the interventricular septum.
  • Purkinje fibers: Distribute the electrical impulse throughout the ventricles, stimulating them to contract uniformly and powerfully.

The correct sequence for the pathway of an action potential through the heart follows a route designed to efficiently coordinate the heartbeat starting from the initiation of the action potential to the consequential contraction of the heart muscles. The sequence is:

  1. SA node (E): The pacemaker where the electrical activity originates.
  2. AV node (C): Where the impulse is delayed slightly.
  3. AV bundle (A): Conducts the impulse from the AV node to the bundle branches.
  4. Bundle branches (D): Leads the impulse to the Purkinje fibers.
  5. Purkinje fibers (B): Distributes the impulse throughout the ventricles.

By examining the options provided with the above understanding:

  • Option A: E-C-A-D-B
  • Option B: A-E-C-B-D
  • Option C: B-D-E-C-A
  • Option D: E-A-D-B-C

Option A (E-C-A-D-B) correctly reflects the order in which the electrical impulse travels through the cardiac conduction system, beginning with the SA node and ending in the Purkinje fibers. Hence, Option A is the correct answer.

Q.73

Match List I with List II :

List - I List - II
A. P wave (i) Heart muscles are electrically silent.
B. QRS complex (ii) Depolarisation of ventricles.
C. T wave (iii) Depolarisation of atria.
D. T-P gap (iv) Repolarisation of ventricles.

Choose the correct answer from the options given below :

(A)
A-I, B-III, C-IV, D-II
(B)
A-III, B-II, C-IV, D-I
(C)
A-II, B-III, C-I, D-IV
(D)
A-IV, B-II, C-I, D-III
(B)

Solution

Option B:

A. P wave corresponds to (iii) Depolarisation of atria.

B. QRS complex corresponds to (ii) Depolarisation of ventricles.

C. T wave corresponds to (iv) Repolarisation of ventricles.

D. T-P gap corresponds to (i) Heart muscles are electrically silent.

Q.74

Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body:

NEET 2024 Biology - Locomotion and Movement Question 10 English

Name of muscle/location

(A)
(a) Smooth - Toes (b) Skeletal - Legs (c) Cardiac - Heart
(B)
(a) Skeletal - Triceps (b) Smooth - Stomach (c) Cardiac - Heart
(C)
(a) Skeletal - Biceps (b) Involuntary - Intestine (c) Smooth - Heart
(D)
(a) Involuntary - Nose tip (b) Skeletal - Bone (c) Cardiac - Heart
(B)

Solution

The correct answer is option (2) as

Figure (a) represents skeletal muscle fibres which are closely attached to skeletal bones. In a typical muscle such as triceps and biceps, striated muscle fibres are bundled together in a parallel fashion.

Figure (b) represents smooth muscle fibres which are present in the wall of internal organs such as the blood vessels, stomach and intestine.

Figure (c) represents cardiac muscle fibres which are exclusively present in the heart.

Q.75

Match List I with List II :

List - I List - II
A. Fibrous joints I. Adjacent vertebrae, limited movement
B. Cartilaginous joints II. Humerus and Pectoral girdle, rotational movement
C. Hinge joints III. Skull, don't allow any movement
D. Ball and socket joints IV. Knee, help in locomotion

Choose the correct answer from the options given below :

(A)
A-IV, B-II, C-III, D-I
(B)
A-I, B-III, C-II, D-IV
(C)
A-II, B-III, C-I, D-IV
(D)
A-III, B-I, C-IV, D-II
(D)

Solution

To match List I (Types of Joints) with List II (Descriptions/Functions), let us consider each type:

Fibrous Joints (A): These joints are found where bones are closely fitted together, allowing very little or no movement, such as in the sutures of the skull. So, Fibrous joints correspond to: III. Skull, don't allow any movement

Cartilaginous Joints (B): These joints occur where the connection between the articulating bones is made up of cartilage, such as between vertebrae in the spine. These allow for limited movement. So, Cartilaginous joints correspond to: I. Adjacent vertebrae, limited movement

Hinge Joints (C): These include joints like the elbow and knee, where movement is primarily in one axis (like opening and closing a door). So, Hinge joints correspond to: IV. Knee, help in locomotion

Ball and Socket Joints (D): These joints, such as the hip and shoulder joints, allow for a wide range of movement including rotational. So, Ball and socket joints correspond to: II. Humerus and Pectoral girdle, rotational movement

The correct matching based on the descriptions and joint types is:

A-III, B-I, C-IV, D-II

Therefore, the correct answer is:

Option D: A-III, B-I, C-IV, D-II

Q.76

Match List I with List II:

List - I List - II
A. Pons I. Provides additional space for Neurons, regulates posture and balance.
B. Hypothalamus II. Controls respiration and gastric secretions.
C. Medulla III. Connects different regions of the brain.
D. Cerebellum IV. Neuro secretory cells

Choose the correct answer from the options given below :

(A)
A-II, B-III, C-I, D-IV
(B)
A-III, B-IV, C-II, D-I
(C)
A-I, B-III, C-II, D-IV
(D)
A-II, B-I, C-III, D-IV
(B)

Solution

To match List I with List II correctly, we start by identifying the function of each brain region described in List I and match these descriptions to the corresponding functions stated in List II:

  • Pons: The pons is part of the brainstem located between the midbrain and the medulla oblongata. It principally acts as a bridge connecting various parts of the brain, and it is also involved in controlling essential functions like sleep and respiration.
  • Hypothalamus: The hypothalamus is a small portion at the base of the brain that plays a crucial role in hormone release and regulation of essential bodily functions, including temperature control, thirst, hunger, sleep, mood, and sexual behavior. It contains several neurosecretory cells that produce hormones.
  • Medulla: The medulla oblongata, also part of the brainstem, primarily controls autonomic functions such as breathing, heart rate, and digestion (including gastric secretions).
  • Cerebellum: The cerebellum is located at the back of the brain and is responsible for controlling motor skills, balance, coordination, and posture. It helps refine the movements dictated by the motor cortex.

Now, let's match these descriptions to those listed in List II:

  • A. Pons should match with "Connects different regions of the brain." - this corresponds to III.
  • B. Hypothalamus should match with "Neurosecretory cells." - this corresponds to IV.
  • C. Medulla should match with "Controls respiration and gastric secretions." - this corresponds to II.
  • D. Cerebellum should match with "Provides additional space for Neurons, regulates posture and balance." - this corresponds to I.

When we look at the given options:

  • Option A: A-II, B-III, C-I, D-IV (wrong)
  • Option B: A-III, B-IV, C-II, D-I (correct)
  • Option C: A-I, B-III, C-II, D-IV (wrong)
  • Option D: A-II, B-I, C-III, D-IV (wrong)

The correct answer is Option B: A-III, B-IV, C-II, D-I.

Q.77

Given below are two statements:

Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.

Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.

In the light of the above statements, choose the most appropriate answer from the options given below:

(A)
Both Statement I and Statement II are correct.
(B)
Both Statement I and Statement II are incorrect.
(C)
Statement I is correct but Statement II is incorrect.
(D)
Statement I is incorrect but Statement II is correct.
(C)

Solution

Statement I describes the corpus callosum, a structure in the brain. The corpus callosum is a large bundle of nerve fibers that connects the two cerebral hemispheres, allowing for communication between them. This statement is correct.

Statement II mentions the brain stem and lists its components as the medulla oblongata, pons, and cerebrum. The error here is in including the cerebrum as part of the brain stem. In actuality, the brain stem consists of the medulla oblongata, the pons, and the midbrain, not the cerebrum. The cerebrum is part of the forebrain and is responsible for higher cognitive functions such as thinking, perceiving, planning, and understanding language. Therefore, Statement II is incorrect.

Based on the analysis above, the correct answer is:

Option C: Statement I is correct but Statement II is incorrect.

Q.78

Which of the following is not a natural/traditional contraceptive method?

(A)
Coitus interruptus
(B)
Periodic abstinence
(C)
Lactational amenorrhea
(D)
Vaults
(D)

Solution

The answer to which of the listed methods is not a natural/traditional contraceptive method is indeed Option D: Vaults.

Explanation:

Option A: Coitus Interruptus - This method, also known as withdrawal, is when the male withdraws his penis from the vagina prior to ejaculation to avoid depositing sperm in the female reproductive tract. It is considered a traditional form of contraception but carries a higher risk of failure compared to other methods due to the possible presence of sperm in pre-ejaculate or improper timing of withdrawal.

Option B: Periodic Abstinence - Also known as the rhythm method or the calendar method, this involves abstaining from sexual intercourse on the days of a woman’s menstrual cycle when she is most likely to conceive. While it requires awareness of the fertility cycle and careful tracking, it remains a traditional and natural method.

Option C: Lactational Amenorrhea - This method is based on the natural postnatal infertility that occurs when a woman is amenorrheic (not menstruating) and fully breastfeeding her baby. This method can be effective for up to six months postpartum, provided that the conditions of exclusive breastfeeding are strictly met.

Option D: Vaults - This option is likely a misstatement or confusion with "vaginal vaults" or refers to barrier methods like diaphragms or cervical caps, which are not considered natural or traditional methods. These require the insertion of a device into the vagina to block sperm from entering the uterus and thus necessitate manufacturing and healthcare consultation, distinguishing them from natural or traditional methods.

Therefore, Option D, Vaults, is not a natural or traditional method of contraception, unlike the other options listed.

Q.79

Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:

Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.

Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.

In the light of the above statements, choose the most appropriate answer from the options given below:

(A)
Both A and R are correct and R is the correct explanation of A
(B)
Both A and R are correct but R is NOT the correct explanation of A
(C)
A is correct but R is not correct
(D)
A is not correct but R is correct
(A)

Solution

Explanation:

Assertion A states that breast-feeding during the initial period of infant growth is recommended by doctors to bring up a healthy baby. This statement is indeed correct. Breast-feeding is universally recommended by health professionals because mother's milk contains the perfect balance of nutrients essential for the newborn's growth and development. Additionally, breastfeeding promotes better health outcomes for the mother and infant, strengthening the immune system of the baby.

Reason R explains that colostrum, the first form of milk produced immediately following the delivery of the newborn, contains several antibodies absolutely essential to develop resistance for the newborn baby. This statement is also correct. Colostrum is rich in immunoglobulins, particularly IgA, which provide passive immunity to the baby by forming a protective layer in the baby's intestine, thereby preventing infection.

Since both Assertion A and Reason R are correct, and Reason R directly explains why breastfeeding is beneficial — particularly highlighting the role of colostrum in providing immunity which is crucial for the newborn's health, the correct option herein is:

Option A: Both A and R are correct and R is the correct explanation of A.

Q.80

Match List I with List II

List - I List - II
A. Non-medicated IUD I. Multiload 375
B. Copper releasing IUD II. Progestogens
C. Hormone releasing IUD III. Lippes loop
D. Implants IV. LNG-20

Choose the correct answer from the option given below:

(A)
A-III, B-I, C-II, D-IV
(B)
A-I, B-III, C-IV, D-II
(C)
A-IV, B-I, C-II, D-III
(D)
A-III, B-I, C-IV, D-II
(D)

Solution

Let's analyze each item in List-I and find the appropriate match from List-II:

  • Non-medicated IUD - This type of intrauterine device (IUD) does not contain any hormones or active pharmaceutical ingredients. It solely relies on the presence of a foreign body within the uterus to prevent pregnancy. A representative example of a non-medicated IUD is Lippes loop, which is an inert, flexible plastic loop. Therefore, A corresponds to III.
  • Copper releasing IUD - These IUDs release a small amount of copper into the uterus, which enhances contraceptive efficacy. Multiload 375 is a typical example of a copper-releasing IUD as it includes a copper component. Thus, B corresponds to I.
  • Hormone releasing IUD - These IUDs release a hormone to prevent pregnancy. One well-known hormone releasing IUD is LNG-20, also known as Mirena, which releases levonorgestrel, a type of progestogen, directly into the uterus. Consequently, C corresponds to IV.
  • Implants - These are typically small rods containing progestin that are implanted under the skin. Since the description coincides with the progestogens' action (such as Norplant), D corresponds to II.

Based on the analysis:

  1. A corresponds to III (Lippes loop).
  2. B corresponds to I (Multiload 375).
  3. C corresponds to IV (LNG-20).
  4. D corresponds to II (Progestogens).

Therefore, the correct matches for the options are:

Option D: A-III, B-I, C-IV, D-II

Q.81

In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on

(A)
segment
(B)
segment
(C)
and segment
(D)
segment
(B)

Solution

The correct answer is Option B.

Anal cerci in both male and female cockroaches are located at the base of the abdominal segment of their bodies. The cerci are a pair of long, filamentous, sensory appendages that help cockroaches detect movements in the air, which warns them of approaching threats from behind, such as predators. This placement provides an effective mechanism for detecting environmental changes directly around the cockroach's posterior, enhancing their ability to quickly respond and escape threats. The location on the segment is typical and consistent in all cockroaches across different species.

Q.82

Match List I with List II related to digestive system of cockroach.

List - I List - II
A. The structures used for storing of food I. Gizzaard
B. Ring of 6-8 blind tubules at junction of foregut and midgut. II. Gastric Caeca
C. Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut. III. Malpighian tubules
D. The structures used for grinding the food. IV. Crop

Choose the correct answer from the options given below:

(A)
A-IV, B-II, C-III, D-I
(B)
A-I, B-II, C-III, D-IV
(C)
A-IV, B-III, C-II, D-I
(D)
A-III, B-II, C-IV, D-I
(A)

Solution

The digestive system of a cockroach consists of several specialized structures that perform specific functions:

  • Crop is a part of the alimentary canal where food is stored temporarily. This aligns with the description for List I "A. The structures used for storing of food". Thus, A corresponds to IV (Crop).
  • Gastric Caeca are blind tubules located at the junction of the foregut and the midgut in insects. These tubules secrete enzymes and provide an increased surface area for digestion and absorption. This fits the description for List I "B. Ring of 6-8 blind tubules at junction of foregut and midgut". Hence, B corresponds to II (Gastric Caeca).
  • Malpighian tubules are thin filamentous structures present at the junction of the midgut and hindgut. They are primarily involved in excretion and osmoregulation. They match the description for List I "C. Ring of 100-150 yellow coloured thin filaments at junction of midgut and hindgut". Thus, C corresponds to III (Malpighian tubules).
  • Gizzard, also known as the proventriculus, is equipped with hard chitinous plates that grind the food mechanically. This description fits List I "D. The structures used for grinding the food". Therefore, D corresponds to I (Gizzard).

By collaborating all this information, the correct answer is:

Option A: A-IV, B-II, C-III, D-I

Q.83

Match List I with List II:

List - I List - II
A. Unicellular glandular epithelium I. Salivary glands
B. Compound epithelium II. Pancreas
C. Multicellular glandular epithelium III. Goblet cells of alimentary canal
D. Endocrine glandular epithelium IV. Moist surface of buccal cavity

Choose the correct answer from the options given below:

(A)
A-II, B-I, C-III, D-IV
(B)
A-IV, B-III, C-I, D-II
(C)
A-III, B-IV, C-I, D-II
(D)
A-II, B-I, C-IV, D-III
(C)

Solution

To match List I (types of epithelium) with List II (examples where these epithelia are found), we need to understand the characteristics and common locations of each type of epithelial tissue.

Here's the clarification for each match:

Unicellular glandular epithelium: This refers to single cells that function as glands, such as goblet cells. They are typically found in epithelial linings where they secrete mucus; within the digestive tract, goblet cells are common components.

Compound epithelium: This type is characterized by multiple layers of cells and is primarily protective. Common examples include skin and the inner lining of the mouth which needs protection against mechanical and chemical stress.

Multicellular glandular epithelium: This is found in glands composed of many cells. Examples include the salivary glands, pancreas, etc., where multiple cells work together to produce and secrete substances like enzymes and saliva.

Endocrine glandular epithelium: These glands are ductless and release hormones directly into the blood. An example of such a gland is the pancreas, which not only acts as an exocrine gland by producing digestive enzymes but also functions endocrinologically by regulating blood sugar levels through insulin and glucagon production.

Based on the above understanding:

  • A (Unicellular glandular epithelium) matches with III (Goblet cells of alimentary canal).
  • B (Compound epithelium) matches with IV (Moist surface of buccal cavity).
  • C (Multicellular glandular epithelium) matches with I (Salivary glands).
  • D (Endocrine glandular epithelium) matches with II (Pancreas).

Thus, the correct answer is Option C: A-III, B-IV, C-I, D-II.

Q.84

Given below are two statements :

Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes.

Statement II : The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.

In the light of the above statements, choose the correct answer from the option given below :

(A)
Both Statement I and Statement II are true
(B)
Both Statement I and Statement II are false
(C)
Statement I is true but Statement II is false
(D)
Statement I is false but Statement II is true
(B)

Solution

Correct answer is option (B) because Statement I is false as the descending limb of loop of Henle is permeable to water and almost impermeable to electrolytes.

Statement II is false as proximal convoluted tubule is lined by simple cuboidal brush border epithelium which increases the surface area for reabsorption.

Q.85

Choose the correct statement given below regarding juxta medullary nephron.

(A)
Juxta medullary nephrons are located in the columns of Bertini.
(B)
Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.
(C)
Loop of Henle of juxta medullary nephron runs deep into medulla.
(D)
Juxta medullary nephrons outnumber the cortical nephrons.
(C)

Solution

The juxta medullary nephrons are one of the two types of nephrons found in the kidneys, specifically in mammals, including humans. These nephrons have distinctive characteristics and play crucial roles in the process of urine concentration, which is essential for water conservation and the regulation of blood pressure.

Option A: Juxta medullary nephrons are located in the columns of Bertin.

This option is incorrect. The juxta medullary nephrons are not located in the columns of Bertin. The columns of Bertin, or renal columns, are extensions of the renal cortex located between the renal pyramids. They consist primarily of lines of blood vessels and cortical material. The juxta medullary nephrons, however, have their renal corpuscles located at the deep cortex, close to the medulla, not within the columns of Bertin.

Option B: Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.

This option is incorrect. In juxta medullary nephrons, the renal corpuscles are not located in the outer portion of the renal medulla but are located deep in the renal cortex, close to the medulla. The renal corpuscles include the glomerulus and Bowman's capsule, which are essential for the filtration of blood.

Option C: Loop of Henle of juxta medullary nephron runs deep into the medulla.

This option is correct. The defining characteristic of juxta medullary nephrons is the long loops of Henle that extend deep into the renal medulla. This structural feature is critical for establishing the conditions needed for the concentration of urine, as it allows for a significant reabsorption of water and solutes under the influence of various gradients.

Option D: Juxta medullary nephrons outnumber the cortical nephrons.

This option is incorrect. Juxta medullary nephrons are much less numerous than cortical nephrons. Cortical nephrons make up the majority of nephrons in the kidneys and are primarily involved in the filtering of blood and initial urine formation under different conditions.

In summary, the correct statement about juxta medullary nephrons from the provided options is Option C: Loop of Henle of juxta medullary nephron runs deep into the medulla.

Q.86

Which of the following is not a steroid hormone?

(A)
Cortisol
(B)
Testosterone
(C)
Progesterone
(D)
Glucagon
(D)

Solution

Steroid hormones are a class of hormones that are derived from cholesterol and are lipophilic (fat-soluble) in nature. They can easily pass through the cell membranes of target cells to bind with intracellular receptors. Common examples of steroid hormones include cortisol, testosterone, and progesterone, each involved in different regulatory functions in the body.

Cortisol (Option A) is a glucocorticoid hormone produced by the adrenal cortex. It is involved in the regulation of metabolism, immune response, and stress response.

Testosterone (Option B) is an androgen hormone primarily produced in the testes in males and in smaller quantities in the ovaries in females. It plays a key role in developing male reproductive tissues and promoting secondary sexual characteristics such as muscle and bone mass, and the growth of body hair.

Progesterone (Option C) is a hormone released by the ovaries and is important in the regulation of menstruation and maintaining the early stages of pregnancy.

Glucagon (Option D) is fundamentally different from the aforementioned hormones. It is a peptide hormone, not a steroid hormone. Glucagon is produced by the alpha cells of the pancreas and works to raise the concentration of glucose in the bloodstream by promoting gluconeogenesis and glycogenolysis in the liver. Unlike steroid hormones, glucagon does not pass through cell membranes but binds to receptors on the cell surface.

Thus, the correct answer to the question is Option D: Glucagon, as it is not a steroid hormone.

Q.87

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :

Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male.

Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being.

In the light of the above statements, choose the correct answer from the options given below :

(A)
Both A and R are true and R is the correct explanation of A
(B)
Both A and R are true but R is NOT the correct explanation of A
(C)
A is true but R is false
(D)
A is false but R is true
(D)

Solution

Statement Assertion A states that "FSH acts upon ovarian follicles in female and Leydig cells in male." To analyze this, we need to examine the role of FSH (Follicle Stimulating Hormone) in both genders.

In females, FSH indeed acts on ovarian follicles. It stimulates the growth and maturation of these follicles, which is critical for oocyte development and estrogen production. Consequently, FSH plays a fundamental role in the menstrual cycle and fertility in females.

In males, however, FSH acts on the Sertoli cells, not the Leydig cells. The function of FSH in males is to promote spermatogenesis by acting on Sertoli cells in the testes, which support the development of sperm. On the other hand, Leydig cells, influenced by Luteinizing Hormone (LH), are responsible for the production of testosterone, a primary male sex hormone.

Moving on to Reason R, which asserts that "Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being." Both parts of this statement are accurate. In females, the growing ovarian follicles indeed secrete estrogen, pivotal in regulating the female reproductive cycle and secondary sexual characteristics. In males, interstitial cells, another term for Leydig cells, produce androgens, like testosterone, vital for male reproductive functions and characteristics.

Given this, Assertion A is false because its statement about FSH acting on Leydig cells in males is incorrect. However, Reason R is true as it accurately describes hormone secretion by ovarian follicles and Leydig cells in females and males, respectively.

Therefore, the correct answer is:

Option D: A is false but R is true.

Q.88

Match List I with List II :

List - I List - II
A. Exophthalmic goiter I. Excess secretion of cortisol, moon face \& hypergylcemia.
B. Acromegaly II. Hypo-secretion of thyroid hormone and stunted growth.
C. Cushing's syndrome III. Hyper secretion of thyroid hormone \& protruding eye balls.
D. Cretinism IV. Excessive secretion of growth hormone.

Choose the correct answer from the options given below :

(A)
A-I, B-III, C-II, D-IV
(B)
A-IV, B-II, C-I, D-III
(C)
A-III, B-IV, C-II, D-I
(D)
A-III, B-IV, C-I, D-II
(D)

Solution

To solve the matching question, we need to correctly link each disease (List-I) with their corresponding characteristics (List-II). Here is the breakdown of each disease and its effects:

Exophthalmic goiter: Also known as Graves' disease, this is an autoimmune disorder that involves an overactive thyroid (hyperthyroidism) and is characterized by symptoms such as protruding eyeballs. Therefore, this matches with "Hyper secretion of thyroid hormone & protruding eye balls." - from List II (III).

Acromegaly: This condition is caused by excessive secretion of growth hormone, usually from a benign tumor in the pituitary gland, leading to enlarged features (bones, especially in the hands, feet, and face). Thus, it corresponds with "Excessive secretion of growth hormone." - from List II (IV).

Cushing's syndrome: This syndrome is the result of prolonged exposure to high levels of the hormone cortisol. It features symptoms including obesity majorly centered around the abdomen and upper back, moon face, and hyperglycemia. Therefore, it fits "Excess secretion of cortisol, moon face & hyperglycemia." - from List II (I).

Cretinism: This is a condition arising from the deficiency of thyroid hormone in childhood, which causes impaired neurological function, stunted physical growth, and possibly other symptoms. It matches with "Hypo-secretion of thyroid hormone and stunted growth." - from List II (II).

Now, compare these with the available options:

  • Option A - A-I, B-III, C-II, D-IV - Incorrect because the descriptions do not match correctly.
  • Option B - A-IV, B-II, C-I, D-III - Incorrect because the descriptions do not match correctly.
  • Option C - A-III, B-IV, C-II, D-I - Incorrect because of an incorrect assignment for C and D.
  • Option D - A-III, B-IV, C-I, D-II - Correct, as all labels are correctly matched according to the disease and characteristic explanations provided above.

Therefore, the correct answer is Option D.

Q.89

Which of the following is not a component of Fallopian tube?

(A)
Uterine fundus
(B)
Isthmus
(C)
Infundibulum
(D)
Ampulla
(A)

Solution

The Fallopian tubes, also known as oviducts or uterine tubes, are structures in the female reproductive system that stretch from the uterus to the ovaries. These tubes play a crucial role in the journey of the egg from the ovary to the uterus. The primary components of the Fallopian tubes include the infundibulum, ampulla, and isthmus:

  • Infundibulum: This is the funnel-shaped end of the Fallopian tube nearest the ovary. Its edges are fringed with structures known as fimbriae, which help in capturing the egg released from the ovary.

  • Ampulla: Representing the longest portion of the Fallopian tube, the ampulla forms about half of its length. It is typically where fertilization occurs when a sperm meets an egg.

  • Isthmus: This is the narrower region of the tube that connects to the uterus.

When examining the options provided, Option A mentions the "Uterine fundus". The fundus is actually the top part of the uterus, situated above the openings of the Fallopian tubes into the uterine cavity. The fundus of the uterus is not a part of the Fallopian tubes; instead, it is a region of the uterus itself. Therefore, the correct answer is:

Option A: Uterine fundus

Q.90

Given below are two statements:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above above statements, choose the correct answer from the options given below :

(A)
Both Statement I and Statement II are true
(B)
Both Statement I and Statement II are false
(C)
Statement I is true but Statement II is false
(D)
Statement I is false but Statement II is true
(C)

Solution

To answer this question correctly, we need to evaluate the facts around each statement individually before making a comparison:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

This statement is true. The hymen is a thin, elastic membrane located at the entrance to the vagina. Contrary to common belief, the hymen is not an impermeable barrier that is always torn when virginity is lost via sexual intercourse. It can vary greatly in shape and size from person to person. Some girls are born without a hymen, some have small hymenal tissue, and others have hymens that are very elastic. Moreover, the hymen can be stretched or torn during a variety of non-sexual activities such as tampon use, physical exercise (e.g., biking, gymnastics), or medical examinations. Therefore, the state of the hymen is not a definite indicator of virginity, making statement I true.

Statement II: The hymen is torn during the first coitus only.

This statement is false. As previously mentioned, the hymen can be stretched or torn by activities that are not sexual in nature. Additionally, many women may not experience tearing of the hymen at all during their first sexual intercourse. In cases where the hymen is more elastic or resilient, it may not tear during sexual activity. Furthermore, there are practices and surgeries, such as hymenoplasty, that can restore or create a hymen-like structure, indicating that the hymen can be altered multiple times throughout a woman's life. Thus, the claim that the hymen is torn only during the first coitus is incorrect.

Based on the explanations provided:

Option C (Statement I is true but Statement II is false) is the correct answer.

Q.91

Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

NEET 2024 Biology - Human Reproduction Question 18 English

(A)
FSH, Leydig cells, Sertoli cells, spermiogenesis.
(B)
ICSH, Interstitial cells, Leydig cells, spermiogenesis.
(C)
FSH, Sertoli cells, Leydig cells, spermatogenesis.
(D)
ICSH, Leydig cells, Sertoli cells, spermatogenesis.
(A)

Solution

The correct answer is option no. (1) as

NEET 2024 Biology - Human Reproduction Question 18 English Explanation

(A) is FSH which is a pituitary hormone.

(B) is Leydig cells which are found in the interstitial space outside of the seminiferous tubules.

(C) is Sertoli cells are found inside the seminiferous tubules.

(D) is Spermiogenesis which is a process that helps in transformation of spermatids into spermatozoa.

Q.92

Match List I with List II:

List - I List - II
A. Pleurobrachia I. Mollusca
B. Radula II. Ctenophora
C. Stomochord III. Osteichthyes
D. Air bladder IV. Hemichordata

Choose the correct answer from the options given below :

(A)
A-IV, B-II, C-III, D-I
(B)
A-II, B-I, C-IV, D-III
(C)
A-II, B-IV, C-I, D-III
(D)
A-IV, B-III, C-II, D-I
(B)

Solution

To solve this matching question, we must evaluate each term in List I and determine its corresponding class or phylum in List II. Let's analyze each match:

Pleurobrachia: Pleurobrachia is a genus that belongs to the phylum Ctenophora, which is commonly known as comb jellies. Thus, A should be matched with II (Ctenophora).

Radula: A radula is a toothed, chitinous organ found within mollusks that is used for scraping or cutting food before the food enters the esophagus. Hence, B should be matched with I (Mollusca).

Stomochord: The stomochord is a small, tubular structure found in the collar of hemichordates, a fundamental character previously thought to link hemichordates and chordates. Therefore, C should be matched with IV (Hemichordata).

Air bladder: The air bladder, or swim bladder, is a gas-filled sac present in many bony fish that helps to maintain buoyancy. Hence, D should be matched with III (Osteichthyes, a class of bony fish).

Now, let's review the options given:

  • Option A: A-IV, B-II, C-III, D-I
  • Option B: A-II, B-I, C-IV, D-III
  • Option C: A-II, B-IV, C-I, D-III
  • Option D: A-IV, B-III, C-II, D-I

The correct matches, based on the classification should be: A-II, B-I, C-IV, D-III. Therefore, the correct answer is:

Option B

Q.93

Consider the following statements :

A. Annelids are true coelomates

B. Poriferans are pseudocoelomates

C. Aschelminthes are acoelomates

D. Platyhelminthes are pseudocoelomates

Choose the correct answer from the options given below :

(A)
B only
(B)
A only
(C)
C only
(D)
D only
(B)

Solution

Let's evaluate each statement with regard to the type of body cavity they describe:

A. Annelids are true coelomates: This statement is correct. Annelids (segmented worms, including earthworms) possess a true coelom, which is a body cavity fully lined with a mesodermal layer more specifically called peritoneum. This allows for the distinction of the internal organs from the body wall, and it facilitates greater complexity and organization of the internal structures.

B. Poriferans are pseudocoelomates: This statement is incorrect. Poriferans (sponges) do not have any type of body cavity. Sponges are at a basic level of complexity and lack true tissues and organs, including a coelom or a pseudocoelom. They are considered to have no body cavity and are thus neither coelomates nor pseudocoelomates.

C. Aschelminthes are acoelomates: This statement is incorrect. Aschelminthes, more commonly referred to as Nematoda or roundworms, are actually pseudocoelomates. They possess a pseudocoelom, which is a body cavity that is not entirely lined by mesodermal tissue, unlike a true coelom. The pseudocoel serves as a rudimentary circulatory system and provides a space for internal organs.

D. Platyhelminthes are pseudocoelomates: This statement is incorrect. Platyhelminthes (flatworms) are acoelomates, meaning they lack any body cavity. Their bodies are solid between the digestive tract and the body wall, lacking a filled cavity that would separate these structures.

From the analysis above, only statement A is accurate:

  • A. Annelids are true coelomates - Correct
  • B. Poriferans are pseudocoelomates - Incorrect
  • C. Aschelminthes are acoelomates - Incorrect
  • D. Platyhelminthes are pseudocoelomates - Incorrect

Thus, the correct answer to the question is:

Option B: A only

Q.94

Match List I with List II :

List - I List - II
A. Pterophyllum I. Hag fish
B. Myxine II. Saw fish
C. Pristis III. Angel fish
D. Exocoetus IV. Flying fish

Choose the correct answer from the options given below :

(A)
A-II, B-I, C-IIII, D-IV
(B)
A-III, B-I, C-II, D-IV
(C)
A-IV, B-I, C-II, D-III
(D)
A-III, B-II, C-I, D-IV
(B)

Solution

Let's analyze the match between the items in List I and those in List II. We will specifically address the scientific names provided in List I and match them with their common names given in List II:

List I (Scientific Names) with List II (Common Names):

  • Pterophyllum (A) -> Angel fish (III): Pterophyllum is the scientific name for a type of cichlid commonly called angel fish. Therefore, A matches with III.
  • Myxine (B) -> Hag fish (I): Myxine is the genus for hagfish, which are known for their slime-producing capability. Hence, B matches with I.
  • Pristis (C) -> Saw fish (II): Pristis is the genus comprising the sawfishes, which are known for their long, saw-like rostrums. Consequently, C matches with II.
  • Exocoetus (D) -> Flying fish (IV): Exocoetus is a genus of marine fish known as flying fish, due to their ability to glide above the water's surface for short distances. Therefore, D matches with IV.

Now, compiling these matches together:

  • A - III
  • B - I
  • C - II
  • D - IV

The correct option that matches each scientific name with their respective common names accordingly is:

Option B:

A-III, B-I, C-II, D-IV

Q.95

The following are the statements about non-chordates:

A. Pharynx is perforated by gill slits.

B. Notochord is absent.

C. Central nervous system is dorsal.

D. Heart is dorsal if present.

E. Post anal tail is absent.

Choose the most appropriate answer from the options given below:

(A)
A & C only
(B)
A, B & D only
(C)
B, D & E only
(D)
B, C & D only
(C)

Solution

The correct answer is Option C: B, D & E only. Here's why:

  • B. Notochord is absent: This is the defining characteristic of non-chordates. Chordates possess a notochord at some stage of their development, while non-chordates do not.

  • D. Heart is dorsal if present: In non-chordates with a circulatory system, the heart is located on the dorsal (back) side of the body, unlike chordates where it's ventral (front).

  • E. Post anal tail is absent: Non-chordates lack a post-anal tail, a feature present in chordates.

Why the other options are incorrect:

  • A. Pharynx is perforated by gill slits: This is a characteristic of chordates, particularly in aquatic forms for respiration.

  • C. Central nervous system is dorsal: While this is true for chordates, non-chordates have a ventral nerve cord.
Q.96

Match List I with List II:

List - I List - II
A. Expiratory capacity I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume
B. Functional residual capacity II. Tidal volume + Expiratory reserve volume
C. Vital capacity III. Tidal volume + Inspiratory reserve volume
D. Inspiratory capacity IV. Expiratory reserve volume + Residual volume

Choose the correct answer from the options given below :

(A)
A-II, B-IV, C-I, D-III
(B)
A-III, B-II, C-IV, D-I
(C)
A-II, B-I, C-IV, D-III
(D)
A-I, B-III, C-II, D-IV
(A)

Solution

First, let's define each term listed in List I and match them with their appropriate descriptions in List II.

List I:

  • Expiratory Capacity (EC): This is the maximum volume of air that a person can expel from the lungs after a normal tidal expiration. It is composed of the expiratory reserve volume (ERV) and tidal volume (TV).
  • Functional Residual Capacity (FRC): This represents the volume of air present in the lungs at the end of a passive expiration. It is the sum of the residual volume (RV) and the expiratory reserve volume (ERV).
  • Vital Capacity (VC): This includes the total volume of air that can be expelled from the lungs after taking as deep an inhalation as possible. Hence, this comprises the tidal volume (TV), inspiratory reserve volume (IRV), and the expiratory reserve volume (ERV).
  • Inspiratory Capacity (IC): It refers to the volume of air that can be inhaled after a normal expiration. This combines tidal volume (TV) and inspiratory reserve volume (IRV).

List II:

  • I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume = Vital Capacity (VC).
  • II. Tidal volume + Expiratory reserve volume = Expiratory Capacity (EC).
  • III. Tidal volume + Inspiratory reserve volume = Inspiratory Capacity (IC).
  • IV. Expiratory reserve volume + Residual volume = Functional Residual Capacity (FRC).

Now, let's match the terms:

  • A (Expiratory Capacity) matches with II.
  • B (Functional Residual Capacity) matches with IV.
  • C (Vital Capacity) matches with I.
  • D (Inspiratory Capacity) matches with III.

The correct option that pairs these correctly is:

Option A: A-II, B-IV, C-I, D-III.

Q.97

Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

(A)
High and High
(B)
High and Lesser concentration
(C)
Low and High concentration
(D)
Low and High temperature
(B)

Solution

The formation of oxyhemoglobin in the alveoli is primarily influenced by the partial pressure of oxygen (), partial pressure of carbon dioxide (), hydrogen ion concentration (), and temperature. Understanding these factors will help in selecting the right option that describes the conditions favorable for maximizing the binding of oxygen to hemoglobin in the lungs.

1. Oxygen Partial Pressure (): High enhances the formation of oxyhemoglobin. In the alveoli, where gas exchange occurs, the is relatively high, making it a favorable condition for oxyhemoglobin formation as oxygen molecules bind readily to hemoglobin.

2. Carbon Dioxide Partial Pressure (): Lower is favorable in the alveoli for oxyhemoglobin formation. High leads to a lower pH (due to formation of carbonic acid), which can cause the release of O2 from hemoglobin (Bohr effect), reducing hemoglobin's affinity for oxygen.

3. Hydrogen Ion Concentration (): Lesser concentration, or higher pH, increases the affinity of hemoglobin for oxygen. In alkaline conditions (higher pH), hemoglobin is more likely to bind oxygen, thus forming oxyhemoglobin.

4. Temperature: Temperature also affects oxygen binding. Lower temperatures generally enhance the uptake of oxygen by hemoglobin. However, since the lung environment maintains a stable temperature, significant fluctuations in temperature are less of a consideration in this context compared to , , and concentration.

Given these points, Option B - High and Lesser concentration - best describes the conditions that are favorable for the formation of oxyhemoglobin in the alveoli. High ensures that more oxygen molecules are available to bind with hemoglobin, and a lower concentration (higher pH) reduces the release of oxygen from hemoglobin, thereby increasing oxygen uptake.

Q.98

The flippers of the Penguins and Dolphins are the example of the

(A)
Adaptive radiation
(B)
Natural selection
(C)
Convergent evolution
(D)
Divergent evolution
(C)

Solution

The flippers of penguins and dolphins are examples of convergent evolution. Convergent evolution occurs when different species independently evolve similar traits or structures because they adapt to similar environments or ecological niches, despite being of different lineages. This phenomenon leads to analogous structures, which perform similar functions but are not derived from a common ancestral trait.

Penguins are birds, and dolphins are mammals. Their ancestors did not possess flippers, but both these species have evolved this similar structure, which helps in swimming efficiently in aquatic environments. The development of flippers in both cases is an adaptation to enhance their abilities in similar environments (aquatic life), even though they come from different evolutionary paths.

Therefore, the correct answer is:

Option C: Convergent evolution

Q.99

Given below are some stages of human evolution.

Arrange them in correct sequence. (Past to Recent)

A. Homo habilis

B. Homo sapiens

C. Homo neanderthalensis

D. Homo erectus

Choose the correct sequence of human evolution from the options given below:

(A)
D-A-C-B
(B)
B-A-D-C
(C)
C-B-D-A
(D)
A-D-C-B
(D)

Solution

To correctly arrange the stages of human evolution from past to most recent, we must place these species in chronological order based on when they first appeared according to scientific evidence.

  1. Homo habilis - Often considered one of the earliest members of the genus Homo, appearing around 2.1 to 2.8 million years ago.

  2. Homo erectus - Appeared around 1.9 million years ago and is known for its longer survival until about 140,000 years ago in some regions.

  3. Homo neanderthalensis (Neanderthals) - Emerged around 400,000 years ago and disappeared around 40,000 years ago.

  4. Homo sapiens - Our own species, which emerged around 300,000 years ago and is the only surviving species of the genus Homo.

Based on this information, the correct sequence from past to most recent would be:

  • A. Homo habilis

  • D. Homo erectus

  • C. Homo neanderthalensis

  • B. Homo sapiens

Thus, the correct sequence is represented by:

Option D: A-D-C-B.

Q.100

Match List I with List II:

List - I List - II
A. Mesozoic Era I. Lower invertebrates
B. Proterozoic Era II. Fish & Amphibia
C. Cenozoic Era III. Birds & Reptiles
D. Paleozoic Era IV. Mammals

Choose the correct answer from the options given below :

(A)
A-II, B-I, C-III, D-IV
(B)
A-III, B-I, C-II, D-IV
(C)
A-I, B-II, C-IV, D-III
(D)
A-III, B-I, C-IV, D-II
(D)

Solution

The question requires matching events in historical geological eras to the prevalent life forms of those periods. To do this accurately, knowledge of what characterized each era in terms of biodiversity is essential. Here's a breakdown:

  • Mesozoic Era (A): This era, often called the "Age of Reptiles," is renowned for its diverse reptilian species, including the dinosaurs, and also saw the emergence of birds from theropod dinosaurs. Hence, Mesozoic Era matches with "Birds & Reptiles (III)".

  • Proterozoic Era (B): The Proterozoic Era is part of the Precambrian period, characterized by the rise of simple, mostly unicellular life, including the first complex eukaryotic cells and multicellular forms like the Ediacara biota. Therefore, it should match with "Lower invertebrates (I)".

  • Cenozoic Era (C): Known as the "Age of Mammals," this period saw mammals diversifying after the extinction of the dinosaurs at the K-T boundary (the transition from Mesozoic to Cenozoic). Therefore, Cenozoic Era matches with "Mammals (IV)".

  • Paleozoic Era (D): During the Paleozoic Era, marine life flourished, and vertebrates began to emerge, including fishes and the first tetrapods (amphibians). Thus, Paleozoic Era corresponds to "Fish & Amphibia (II)".

Therefore, the correct matching based on the information given would be:

Option D: A-III, B-I, C-IV, D-II. This option accurately aligns each era with the dominant life forms characterized within those eras.